Активное сопротивление меди: Активное и индуктивное сопротивление кабелей + таблица

Содержание

Активное и индуктивное сопротивление кабелей + таблица

В любых электрических сетях имеет место потеря напряжения под влиянием различных факторов. В основном это такие параметры, как проводимость и сопротивление, которые следует учитывать при выполнении расчетов. Для цепей постоянного тока можно обойтись обычными характеристиками. Однако, при использовании переменного тока потребуется вычислить активное и индуктивное сопротивление кабелей. Для того чтобы правильно ориентироваться в этих параметрах, необходимо хорошо представлять себе особенности каждого из них.

Особенности активного сопротивления

Сопротивление в электротехнике является важнейшим параметром, с помощью которого какая-то часть электрической цепи оказывает противодействие проходящему по ней току. Образованию данной величины способствуют изменения электроэнергии и ее переход в другие виды энергетических состояний.

Подобное явление характерно лишь для переменного тока, под действием которого образуются активные и реактивные сопротивления кабелей. Этот процесс представляет собой необратимые изменения энергии или передачу и распределение ее между отдельными элементами цепи. Если изменения электроэнергии принимают необратимый характер, то такое сопротивление будет активным, а если имеют место обменные процессы, оно становится реактивным. Например, электрическая плита выделяет тепло, которое обратно в электрическую энергию уже не превращается.

Данное явление в полной мере затрагивает любые виды провода и кабеля. При одинаковых условиях, они будут по-разному сопротивляться прохождению постоянного и переменного тока. Подобная ситуация возникает из-за неравномерного распределения переменного тока по сечению проводника, в результате чего образуется так называемый поверхностный эффект.

Таблица и расчет по формуле

Как показывает таблица, поверхностный эффект не критично влияет на проводники, состоящие из цветных металлов и работающие при переменном напряжении с частотой 50 Гц. Поэтому для выполнения расчетов, сопротивления таких кабелей под действием постоянного и переменного тока принимаются условно равными.

Кроме таблицы, для расчетов проводников из алюминия и меди используется специальная формула r = (l * 103)/ γ3 * S = r * l, в которой l – длина (км), γ – удельное значение проводимости конкретного материала (м/ом * мм2), r – активное сопротивление 1 км кабеля (Ом/км), S – поперечное сечение (мм2).

Значение активного сопротивления кабелей зависит также от температуры окружающей среды. Для того чтобы вычислить r при точной температуре Θ, необходимо воспользоваться еще одной формулой r = r20 * [l + α * (Θ – 20)] = (l * 103)/ γ20 * S * [l + α * (Θ – 20)]. Здесь α является температурным коэффициентом сопротивления, r

20 – активное сопротивление при t 20C, γ20 – удельная проводимость при этой же температуре. Эти расчеты необходимы, когда определяется точное активное и индуктивное сопротивление какого-либо проводника.

Активное сопротивление стальных проводов существенно превышает аналогичный показатель проводников из цветных металлов. Это связано с более низкой удельной проводимостью и наличием поверхностного эффекта, выраженного намного ярче по сравнению с медными и алюминиевыми проводами. Кроме того, в линиях со стальными проводами активная энергия значительно теряется на перемагничивание и вихревые токи, поэтому такие потери становятся дополнительным компонентом активного сопротивления.

У стальных проводников существует зависимость активного сопротивления от величины протекающего тока, поэтому в расчетах неприемлемо использование постоянного значения удельной проводимости.

Действие индуктивного сопротивления кабельных линий

Полное сопротивление электрической цепи разделяется на активное и индуктивное сопротивление. Из них последнее является составной частью реактивного сопротивления, возникающего во время прохождения переменного тока через элементы, относящиеся к реактивным. Индуктивность считается основной характеристикой катушек, не учитывая активное сопротивление их обмоток. Как правило, реактивное сопротивление возникает под влиянием ЭДС самоиндукции. При ее росте, в зависимости от частоты тока, происходит одновременное увеличение сопротивления.

Таким образом, активное и реактивное сопротивление кабелей образуют полное сопротивление, которое есть ни что иное, как сумма квадратов каждой составляющей. Графически это отображается в виде прямоугольного треугольника, в котором гипотенуза является полным сопротивлением, а катеты – его составными элементами.

Очень быстро вычислить активное и индуктивное сопротивление кабелей помогает таблица, в которой отражаются основные характеристики наиболее распространенных проводников. Однако довольно часто требуется определить индуктивное сопротивление Х кабельной линии с определенной протяженностью. Для этого применяется простая первоначальная формула Х = Хl, где Х является индуктивным сопротивлением 1 км проводника, а l – длина этого проводника. Полученный результат измеряется в единицах Ом/км.

В свою очередь Х определяется по другой формуле X = 0,145lg * (2Dср/d) + 0,0157 μт, в которой 2Dср является средним расстоянием между проводниками или центрами кабельных жил, d – диаметр этих проводников или жил, μ

т – отражает относительную магнитную проницаемость металла проводника. Таким образом, при увеличении сечения проводника реактивное сопротивление Х будет незначительно уменьшаться.

Расчёт комплексного сопротивления круглого провода

 

Ввиду недостаточных вычислительных возможностей JavaScript (21 значащая цифра), конечная частота в расчёте ограничена (зависит от диаметра провода).

 

 

Ввиду большого объёма производимых расчётов возможны задержки (в пределах нескольких секунд) в построении графиков.

Зависимость комплексного сопротивления (Ом) от частоты (Гц)

 

 

Зависимость толщины скин-слоя (мм) от частоты (Гц)

 

 

Пояснения к расчёту

Расчёт комплексного сопротивления Z круглого провода переменному току с учётом поверхностного (скин) эффекта может быть выражено через параметры поля:

 где: 

R — активное сопротивление

X — реактивное сопротивление

r0 — радиус провода

l — длина провода

μ — относительная магнитная проницаемость

μ0 — магнитная постоянная

μ μ0 — абсолютная магнитная проницаемость

γ — электрическая проводимость

J0(Z) — функция Бесселя нулевого порядка

J1(Z) — функция Бесселя первого порядка

 

Глубину, на которой амплитуда волны уменьшается в е (~2,71828) раз, условно принимают за толщину скин-слоя (глубину проникновения поля):

 

Пожелания, замечания, рекомендации по улучшению раздела расчётов на нашем сайте просьба присылать по электронной почте [email protected] ru

Разрешается копирование java-скриптов при условии ссылки на источник.

 

ВСЕ РАСЧЁТЫ

Полное сопротивление кабельной линии — Акадо-Гид

В любых электрических сетях имеет место потеря напряжения под влиянием различных факторов. В основном это такие параметры, как проводимость и сопротивление, которые следует учитывать при выполнении расчетов. Для цепей постоянного тока можно обойтись обычными характеристиками. Однако, при использовании переменного тока потребуется вычислить активное и индуктивное сопротивление кабелей, которые специальная таблица отображает с высокой точностью в разных вариантах. Для того чтобы правильно ориентироваться в этих параметрах, необходимо хорошо представлять себе особенности каждого из них.

Особенности активного сопротивления

Сопротивление в электротехнике является важнейшим параметром, с помощью которого какая-то часть электрической цепи оказывает противодействие проходящему по ней току.

Образованию данной величины способствуют изменения электроэнергии и ее переход в другие виды энергетических состояний.

Подобное явление характерно лишь для переменного тока, под действием которого образуются активные и реактивные сопротивления кабелей. Этот процесс представляет собой необратимые изменения энергии или передачу и распределение ее между отдельными элементами цепи. Если изменения электроэнергии принимают необратимый характер, то такое сопротивление будет активным, а если имеют место обменные процессы, оно становится реактивным. Например, электрическая плита выделяет тепло, которое обратно в электрическую энергию уже не превращается.

Данное явление в полной мере затрагивает любые виды провода и кабеля. При одинаковых условиях, они будут по-разному сопротивляться прохождению постоянного и переменного тока. Подобная ситуация возникает из-за неравномерного распределения переменного тока по сечению проводника, в результате чего образуется так называемый поверхностный эффект.

Таблица и расчет по формуле

Как показывает таблица, поверхностный эффект не критично влияет на проводники, состоящие из цветных металлов и работающие при переменном напряжении с частотой 50 Гц. Поэтому для выполнения расчетов, сопротивления таких кабелей под действием постоянного и переменного тока принимаются условно равными.

Кроме таблицы, для расчетов проводников из алюминия и меди используется специальная формула r = (l * 10 3 )/ γ 3 * S = r * l, в которой l – длина (км), γ – удельное значение проводимости конкретного материала (м/ом * мм 2 ), r – активное сопротивление 1 км кабеля (Ом/км), S – поперечное сечение (мм 2 ).

Значение активного сопротивления кабелей зависит также от температуры окружающей среды. Для того чтобы вычислить r при точной температуре Θ, необходимо воспользоваться еще одной формулой r = r20 * [l + α * (Θ – 20)] = (l * 10 3 )/ γ20 * S * [l + α * (Θ – 20)]. Здесь α является температурным коэффициентом сопротивления, r20 – активное сопротивление при t 20 0 C, γ20 – удельная проводимость при этой же температуре. Эти расчеты необходимы, когда определяется точное активное и индуктивное сопротивление какого-либо проводника.

Активное сопротивление стальных проводов существенно превышает аналогичный показатель проводников из цветных металлов. Это связано с более низкой удельной проводимостью и наличием поверхностного эффекта, выраженного намного ярче по сравнению с медными и алюминиевыми проводами. Кроме того, в линиях со стальными проводами активная энергия значительно теряется на перемагничивание и вихревые токи, поэтому такие потери становятся дополнительным компонентом активного сопротивления.

У стальных проводников существует зависимость активного сопротивления от величины протекающего тока, поэтому в расчетах неприемлемо использование постоянного значения удельной проводимости.

Действие индуктивного сопротивления кабельных линий

Полное сопротивление электрической цепи разделяется на активное и индуктивное сопротивление. Из них последнее является составной частью реактивного сопротивления, возникающего во время прохождения переменного тока через элементы, относящиеся к реактивным. Индуктивность считается основной характеристикой катушек, не учитывая активное сопротивление их обмоток. Как правило, реактивное сопротивление возникает под влиянием ЭДС самоиндукции. При ее росте, в зависимости от частоты тока, происходит одновременное увеличение сопротивления.

Таким образом, активное и реактивное сопротивление кабелей образуют полное сопротивление, которое есть ни что иное, как сумма квадратов каждой составляющей. Графически это отображается в виде прямоугольного треугольника, в котором гипотенуза является полным сопротивлением, а катеты – его составными элементами.

Очень быстро вычислить активное и индуктивное сопротивление кабелей помогает таблица, в которой отражаются основные характеристики наиболее распространенных проводников. Однако довольно часто требуется определить индуктивное сопротивление Х кабельной линии с определенной протяженностью. Для этого применяется простая первоначальная формула Х = Хl, где Х является индуктивным сопротивлением 1 км проводника, а l – длина этого проводника. Полученный результат измеряется в единицах Ом/км.

В свою очередь Х определяется по другой формуле X = 0,145lg * (2Dср/d) + 0,0157 μт, в которой 2Dср является средним расстоянием между проводниками или центрами кабельных жил, d – диаметр этих проводников или жил, μт – отражает относительную магнитную проницаемость металла проводника. Таким образом, при увеличении сечения проводника реактивное сопротивление Х будет незначительно уменьшаться.

Активные и индуктивные сопротивления линии

Электроснабжение > Выбор сечений по допустимой потере напряжения

АКТИВНЫЕ И ИНДУКТИВНЫЕ СОПРОТИВЛЕНИЯ ЛИНИИ

Активное сопротивление проводов и кабелей из цветных металлов определяется по одной из следующих формул:


где r – расчетное удельное сопротивление провода или жилы кабеля, ом мм2 / м;
g – расчетная удельная проводимость провода или жилы кабеля, м / ом мм2;
F – номинальное сечение провода или кабеля, мм2.
Значения удельного сопротивления и удельной проводимости для медных проводов и кабелей:

для алюминиевых проводов и кабелей

Таблица 5-1 Активные сопротивления проводов и кабелей, ом/км

Сечение провода, мм кв.

Медные провода и кабели

Алюминиевые провода и кабели

Индуктивное сопротивление трехфазной линии с проводами из цветных металлов при частоте переменного тока 50 гц определяется по формуле

где d – внешний диаметр провода, мм;
D – среднее геометрическое расстояние между проводами линии, вычисляемое по формуле

где D – расстояния между проводами у каждой пары проводов трехфазной линии, мм.
Активные сопротивления 1 км провода или жилы кабеля приведены в табл. 5-1, индуктивные сопротивления 1 км линии – в табл. 5-2 и 5-4.
Для стальных проводов активное и внутреннее индуктивное сопротивления зависят от протекающего по проводу переменного тока. Общее индуктивное сопротивление воздушной линии, выполненной стальными проводами, определяется как сумма внешнего х’ и внутреннего х» индуктивных сопротивлений:

Таблица 5-2 Индуктивные сопротивления воздушных линий, ом/км

Среднее геометрическое расстояние между проводами, мм

Для того, чтобы произвести расчет электрической сети на потерю напряжения необходимо знать параметры линий, а именно их сопротивления и проводимости. Если производятся расчеты цепей постоянного тока, то вполне достаточно знать только омическое сопротивление линии. А вот при расчете линии переменного тока одного омического сопротивления бывает недостаточно, и помимо активных сопротивлений, необходимо знать еще индуктивные сопротивления и емкостные проводимости проводов и кабелей.

Активное сопротивление проводов и кабелей

Из электротехники известно, что полное сопротивление при равных условиях переменному и постоянному току будут отличаться. Касается это также проводов и кабелей. Это вызвано тем, что переменный ток распределяется по сечению неравномерно (поверхностный эффект). Однако для проводов из цветных металлов и с частотой переменного напряжения 50 Гц этот эффект не оказывает слишком большого влияния и им можно пренебречь. Таким образом, при расчете проводников из цветных металлов, их сопротивления переменному и постоянному току принимаются равными.

На практике активное сопротивление медных и алюминиевых проводников рассчитывают по формуле:

Где: l – длина в км, γ – удельная проводимость материала провода м/ом∙мм 2 , r – активное сопротивление 1 км провода на фазу Ом/км, s – площадь поперечного сечения, мм 2 .

Величина r, как правило, берется из таблиц справочников.

На активное сопротивление провода влияет и температура окружающей среды. Величину r при температуре Θ можно определить по формуле:

Где: α – температурный коэффициент сопротивления; r20 – активное сопротивление при температуре 20 0 С, γ20 – удельная проводимость при температуре в 20 0 С.

Стальные провода обладают значительно большими активными сопротивлениями, чем аналогичные провода из цветных металлов. Его увеличение обусловлено значительно меньшей величиной удельной проводимости и поверхностным эффектом, который у стальных проводов выражен гораздо более ярко, чем у алюминиевых или медных. Более того, в стальных проводах присутствуют потери активной энергии на вихревые токи и перемагничивание, что в схемах замещения линий учитывают дополнительной составляющей активного сопротивления.

Активное сопротивление стальных проводов (в отличии от проводов из цветных металлов) сильно зависит от величины протекаемого тока, поэтому использовать постоянное значение удельной проводимости при расчетах нельзя.

Активное сопротивление стальных проводов в зависимости от протекающего тока аналитически выразить весьма трудно, поэтому для его определения используют специальные таблицы.

Индуктивное сопротивление проводов и кабелей

Для определения индуктивного сопротивления (обозначается Х) кабельной или воздушной линии определенной протяженности в километрах удобно пользоваться выражением:

Где: Х – индуктивное сопротивление одного километра провода или кабеля на фазу, Ом/км.

Х одного километра воздушной или кабельной линии можно определить по формуле:

Где: Dср – расстояние среднее между проводами или центрами жил кабелей, мм; d – диаметр токоведущей жилы кабеля или диаметр провода, мм; μт – относительная магнитная проницаемость материала провода;

Первый член правой части уравнения обусловлен внешним магнитным полем и называется внешним индуктивным сопротивлением Х / . Из этого выражения видно, что Х / зависит только от расстояния между проводами и их диаметра, а так как расстояние между проводами выбирается исходя из номинального напряжения линии, соответственно Х / будет расти с ростом номинального напряжения линии. Х / воздушных линий больше, чем кабельных. Это связано с тем, что токоведущие жилы кабеля располагаются друг к другу значительно ближе, чем провода воздушных линий.

Где: D1:2 расстояние между проводами.

Для одинарной трехфазной линии при расположении проводов по треугольнику:

При горизонтальном или вертикальном расположении проводов трехфазной линии в одной плоскости:

Увеличение сечения проводов линии ведет к незначительному уменьшению Х / .

Второй член уравнения для определения X обусловлен магнитным полем внутри проводника. Он выражает внутреннее индуктивное сопротивление Х // .

Таким образом выражение для Х можно представить в виде:

Для линий из немагнитными материалов μ = 1 внутреннее индуктивное сопротивление Х // по сравнению с внешним Х / составляет ничтожную величину, поэтому им очень часто пренебрегают.

В таком случае формула для определения Х примет вид:

Для практических расчетов индуктивные сопротивления кабелей и проводов определяют по соответствующим таблицам.

В случае приближенных расчетов можно считать для воздушных линий напряжением 6-10 кВ Х = 0,3 – 0,4 Ом/км, а для кабельных Х = 0,08 Ом/км.

Внутренне индуктивное сопротивление стальных проводов сильно отличается от Х // проводов из цветных металлов. Это вызвано тем, что Х // пропорционально магнитной проницаемости μr, которая сильно зависит от величины тока в проводе. Если для проводов из цветных металлов μr = 1, то для стальных проводов μr может достигать величины в 10 3 и даже выше.

Х // для линий прокладываемых стальными проводами пренебрегать нельзя. Как правило, данную величину берут из таблиц, составленных на основе экспериментальных данных.

Сопротивления r и Х // при некоторых значениях тока могут достигать максимальных значений, а затем с увеличением тока уменьшатся. Это явление объясняется магнитным насыщением стали.

Емкостная проводимость линий

Электрические линии, кроме активного и индуктивного сопротивлений, характеризуются и емкостной проводимостью, которая обусловлена емкостью между проводами и между проводам и землей.

Величину рабочей емкости в трехфазной воздушной линии приближенно можно определить по формуле:

Из данной формулы видно, что рабочая емкость будет увеличиваться с увеличением сечения проводов и уменьшением расстояния между ними. Поэтому при равных сечениях токоведущих частей линии низкого напряжения имеют большую рабочую емкость, чем линии высокого напряжения. В следствии небольших расстояний между токоведущими жилами кабеля и большей диэлектрической проницаемости изоляции по сравнению с воздухом рабочая емкость кабельной линии значительно больше, чем емкость воздушной линии.

Емкостная проводимость одноцепной воздушной линии определяется по формуле:

Определение рабочей емкости кабельной линии по формулам, в которые входят диэлектрическая проницаемость изоляции кабеля, геометрические размеры и другие конструктивные особенности, задача не из легких, поэтому значения рабочей емкости определяют по специальным таблицам, составленным заводом изготовителем для различных марок кабелей, в зависимости от их номинального напряжения.

Емкостной ток вначале линии при холостом ходе (при отключенных электроприемниках) можно определить из формулы:

Где: U – линейное напряжение сети, В; l – длина линии, км;

Емкостные токи имеют серьезное значение в воздушных линиях с рабочим напряжением 110 кВ и выше и в кабельных линиях с напряжением выше 10 кВ. При расчете электрических сетей с напряжениями ниже, чем выше перечисленные, емкость линии могут не учитывать. Емкость токопроводящих частей линии по отношению к земле имеет значение при расчете заземляющих устройств и защиты.

В сети с изолированной нейтралью величину емкостного тока однофазного замыкания на землю приближенно можно определить по формулам:

Активное сопротивление — Студопедия

Обусловливает нагрев проводов (тепловые потери) и зависит от мате­риала токоведущих проводников и их сечения. Для линий с проводами не­большого сечения, выполненных цветным металлом (алюминий, медь), ак­тивное сопротивление принимают равным омическому (сопротивлению по­стоянного тока), поскольку проявление поверхностного эффекта при про­мышленных частотах 50-60 Гц незаметно (около 1 %). Для проводов боль­шого сечения (500 мм и более) явление поверхностного эффекта при про­мышленных частотах значительное

Активное погонное сопротивление линии определяется по формуле, Ом/км

(4.2)

где — удельное активное сопротивление материала провода, Ом мм /км; F — сечение фазного провода (жилы), . Для технического алюминия в за­висимости от его марки можно принять = 29,5-31,5 Ом мм /км, для меди = 18,0-19,0 Ом мм2/км.

Активное сопротивление не остаётся постоянным. Оно зависит от тем­пературы провода, которая определяется температурой окружающего возду­ха (среды), скоростью ветра и значением проходящего по проводу тока.

Омическое сопротивление упрощённо можно трактовать как препятст­вие направленному движению зарядов узлов кристаллической решётки мате­риала проводника, совершающих колебательные движения около равновесного состояния. Интенсивность колебаний и соответственно омическое со­противление возрастают с ростом температуры проводника.


Зависимость активного сопротивления от температуры провода t опре­деляется в виде

(4.3)

где- нормативное значение сопротивления R0 , рассчитывается по формуле (4.2), при температуре проводника t=20°С; а — температурный коэф­фициент электрического сопротивления, Ом/град (для медных, алюминиевых и сталеалюминиевых проводов α = 0,00403, для стальных α = 0,00405).

Трудность уточнения активного сопротивления линий по (4.3) заклю­чается в том, что температура провода, зависящая от токовой нагрузки и ин­тенсивности охлаждения, может заметно превышать температуру окружаю­щей среды. Необходимость такого уточнения может возникнуть при расчёте сезонных электрических режимов.

При расщеплении фазы ВЛ на n одинаковых проводов в выражении (4.2) необходимо учитывать суммарное сечение проводов фазы:

(4.4)

4.2. Индуктивное сопротивление

Обусловлено магнитным полем, возникающим вокруг и внутри про­водника при протекании по нему переменного тока. В проводнике наводится ЭДС самоиндукции, направленная в соответствии с принципом Ленца проти­воположно ЭДС источника



Противодействие, которое оказывает ЭДС самоиндукции изменению ЭДС источника, и обусловливает индуктивное сопротивление проводника. Чем больше изменение потокосцепления,, определяемое частотой то­ка = 2nf (скоростью изменения тока di /dt), и величина индуктивности фазы L, зависящая от конструкции (разветвлённости) фазы, и трёхфазной ЛЭП в целом, тем больше индуктивное сопротивление элемента X =L. То есть для одной и той же линии (или просто электрической катушки) с ростом час­тоты питающего тока f индуктивное сопротивление увеличивается. Естественно, что при нулевой частоте =2nf=0, например в сетях постоянного тока, индуктивное сопротивление ЛЭП отсутствует.


На индуктивное сопротивление фаз многофазных ЛЭП оказывает влияние также взаимное расположение фазных проводов (жил). Кроме ЭДС самоиндукции, в каждой фазе наводится противодействующая ей ЭДС взаи­моиндукции. Поэтому при симметричном расположении фаз, например по вершинам равностороннего треугольника, результирующая противодейст­вующая ЭДС во всех фазах одинаковая, а следовательно, одинаковы пропор­циональные ей индуктивные сопротивления фаз. При горизонтальном распо­ложении фазных проводов потокосцепление фаз неодинаковое, поэтому ин­дуктивные сопротивления фазных проводов отличаются друг от друга. Для достижения симметрии (одинаковости) параметров фаз на специальных опо­рах выполняют транспозицию (перестановку) фазных проводов.

Индуктивное сопротивление, отнесённое к 1 км линии, определяется по эмпирической формуле, Ом/км,

(4.5)

Если принять частоту тока 50 Гц, то при указанной частоте = 2nf = 314 рад/с для проводов из цветных металлов (|m = 1) получим, Ом/км,

Однако для ВЛ указанных номинальных напряжений характерны соот­ношения между параметрами R0<<X0. Поэтому увеличение пропускной способности достигается в основном снижением индуктивного сопротивле­ния. При n проводах в фазе увеличивается эквивалентный радиус расщепле­ния конструкции фазы (рис. 4.4):

(4.23)

где а — расстояние между проводами в фазе, равное 40-60 см.

Анализ зависимости (4.23) показывает, что эквивалентный показывает, что эквивалентный радиус фазы изменяется в диапазоне от 9,3см (при n = 2) до 65 см (при n = 10) и малозависит от сечения провода. Основным фактором, определяющим изменение , является количество проводов в фазе. Так как эквивалентный радиус расщеплённой фазы намного больше действительного радиуса провода нерасщеплённой фазы , то индуктивно

сопротивление такой ВЛ, определяемое по преобразованной формуле вида (4.24), Ом/км, уменьшается:

(4.24)

Снижение Х0, достигаемое в основном за счёт уменьшения внешнего сопротивления X0, относительно невелико. Например, при расщеплении фа­зы воздушной линии 500 кВ на три провода — до 0,29-0,30 Ом/км, т. е. при­мерно на треть. Соответственно с уменьшением сопротивления

увеличивается пропускная способность (идеальный предел) линии:

(4.25)

Естественно, что с увеличением эквивалентного радиуса фазы снижается напряжённость электрического поля вокруг фазы и, следователь­но, потери мощности на коронирование. Тем не менее суммарные значения этих потерь для ВЛ высокого и сверхвысокого напряжения (220 кВ и более) составляют заметные величины, учёт которых необходим при анализе режи­мов линий указанных классов напряжений (рис. 4.5).

Расщепление фазы на несколько проводов увеличивает ёмкость ВЛ и соответственно емкостную проводимость:

(4.26)

Например, при расщеплении фазы ВЛ 220 кВ на два провода проводи­мость возрастает с 2,7•10-6 до 3,5•10-6 См/км. Тогда зарядная мощность ВЛ 220 кВ средней протяжённости, например 200 км, составляет

что соизмеримо с передаваемыми мощностями по ВЛ данного класса напря­жения, в частности с натуральной мощностью линии

(4. 27)

4.6. Схемы замещения линий электропередач

Выше приведена характеристика отдельных элементов схем замещения линий. В соответствии с их физическим проявлением при моделировании электрических сетей используют схемы ВЛ, КЛ и шинопроводов, представленные на рис. 4.5, рис. 4.6, рис. 4.7. Приведём некоторые обобщающие пояснения к этим схемам.

При расчёте симметричных установившихся режимов ЭС схему заме­щения составляют для одной фазы, т. е. продольные её параметры, сопротив­ления Z=R+JX изображают и вычисляют для одного фазного провода (жилы), а при расщеплении фазы — с учётом количества проводов в фазе и эквивалентного радиуса фазной конструкции ВЛ.

Ёмкостная проводимость Вс, учитывает проводимости (ёмкости) между фазами, между фазами и землёй и отражает генерацию зарядной мощности всей трёхфазной конструкции линии:

Активная проводимость линии G, изображаемая в виде шунта между фазой (жилой) и точкой нулевого потенциала схемы (землёй), включает сум­марные потери активной мощности на корону (или в изоляции) трёх фаз:

(4. 28)


 
 

Поперечные проводимости (шунты) Y=G+jX в схемах замещения можно не изображать, а заменять мощностями этих шунтов (рис. 4.5, б; рис. 4.6, б). Например, вместо активной проводимости показывают потери активной мощности в ВЛ:

(4.29)

или в изоляции КЛ:

(4.30)

 
 

Взамен ёмкостной проводимости указывают генерацию зарядной мощ­ности

(4.30а)

Указанный учёт поперечных ветвей ЛЭП нагрузками упрощает оценку электрических режимов, выполняемых вручную. Такие схемы замещения ли­ний именуют расчётными (рис. 4.5, б; рис. 4.6, б).

В ЛЭП напряжением до 220 кВ при определённых условиях можно не учитывать те или иные параметры, если их влияние на работу сети несущест­венно. В связи с этим схемы замещения линий, показанные на рис. 4.1, в ряде случаев могут быть упрощены.

В ВЛ напряжением до 220 кВ потери мощности на корону, а в КЛ на­пряжением до 35 кВ диэлектрические потери незначительные. Поэтому в расчетах электрических режимов ими пренебрегают и соответственно при­нимают равной нулю активную проводимость (рис. 4.6). Учёт активной про­водимости необходим для ВЛ напряжением 220 кВ и для КЛ напряжением 110 кВ и выше в расчётах, требующих вычисления потерь электроэнергии, а для ВЛ напряжением 330 кВ и выше также при расчёте электрических режи­мов (рис. 4.5).

Необходимость учёта ёмкости и зарядной мощности линии зависит от соизмеряемости зарядной и нагрузочной мощности. В местных сетях не­большой протяжённости при номинальных напряжениях до 35 кВ зарядные токи и мощности значительно меньше нагрузочных. Поэтому в КЛ ёмкост­ную проводимость учитывают только при напряжениях 20 и 35 кВ, а в ВЛ ею можно пренебречь.

В районных сетях (110 кВ и выше) со значительными протяжённостями (40-50 км и больше) зарядные мощности могут оказаться соизмеримыми с нагрузочными и подлежат обязательному учёту либо непосредственно (рис. 4.6, б) либо введением ёмкостных проводимостей (рис. 4.6, а).

В проводах ВЛ при малых сечениях (16-35 мм2) преобладают активные сопротивления, а при больших сечениях (240 мм2 в районных сетях напряже­нием 220 кВ и выше) свойства сетей определяются их индуктивностями. Активные и индуктивные сопротивления проводов средних сечений (50-185 мм2 ) близки друг к другу. В КЛ напряжением до 10 кВ небольших сече­ний (50 мм2 и менее) определяющим является активное сопротивление, и в таком случае индуктивные сопротивления могут не учитываться (рис. 4.7, б).

Необходимость учёта индуктивных сопротивлений зависит также от доли реактивной составляющей тока в общей электрической нагрузке. При анализе электрических режимов с низкими коэффициентами мощности (cos<0,8) индуктивные сопротивления КЛ необходимо учитывать. В про­тивном случае возможны ошибки, приводящие к уменьшению действитель­ной величины потери напряжения.

Схемы замещения ЛЭП постоянного тока могут рассматриваться как частный случай схем замещения ЛЭП переменного тока при Х = 0 и b = 0.

Параметры тяговых сетей | Электроснабжение электрифицированных железных дорог

Страница 30 из 35

При расчете тяговых сетей необходимо знать сопротивление проводов контактных подвесок, рельсовой сети, питающих и отсасывающих проводов, а в некоторых, случаях — и переходные сопротивления рельс—земля. За исходный параметр принято сопротивление 1 км тяговой сети г, которое представляет собой сумму сопротивлений проводов  и рельсов. На дорогах используют рельсы Р50, Р65 и Р75.
Параметры тяговых сетей постоянного тока. Сопротивление проводов
(41)

Сечение проводов контактной сети выражают в эквиваленте меди, например при медных и алюминиевых проводах (проводимость алюминия в 1,65 раза меньше, чем меди)
(42)
где рм — удельное сопротивление меди, Ом-м;
Sm и s, — соответственно площадь сечения медных и алюминиевых проводов, мм2.
Сопротивление рельсов чаще выражают не через площадь поперечного сечения, а через массу 1 м рельса.
При расчете в условиях эксплуатации учитывают износ контактных проводов и рельсов, т. е. вычисляют сопротивления по фактическому состоянию тяговой сети.

Действительное сопротивление ходовых рельсов отличается от значений, определяемых по приведенным формулам, из-за шунтирующего действия грунта. Так как рельсы не изолированы от земли, то часть тягового тока будет стекать в землю и проходить по ней. Переходное сопротивление рельсы — земля  зависит от состояния шпал, балласта, времени года, влажности и т. п. В летний период оно может составлять 0,25 Ом/км, а в зимний при промерзании балластного слоя может увеличиваться в 10—100 раз. Шунтирующее действие земли увеличивает проводимость рельсового пути, и фактическое сопротивление рельсов можно определить как гфр=кгр (здесь к — коэффициент, зависящий от значения к<1).
Параметры тяговых сетей переменного тока. Падение напряжения в тяговой сети переменного тока определяется активным и индуктивным сопротивлениями. Активное сопротивление зависит от материала, поперечного сечения и формы проводника. Оно больше сопротивления постоянному току из-за наличия поверхностного эффекта, в результате которого плотность тока по площади сечения проводника неодинакова: больше у поверхности и меньше в центральной части. Явление поверхностного эффекта обусловлено магнитной проницаемостью материала, частотой тока и поперечными размерами проводника.
Для медных и алюминиевых проводов при частоте 50 Гц влиянием поверхностного эффекта пренебрегают и принимают активное сопротивление проводов равным их сопротивлению постоянному току. У ходовых рельсов, обладающих высокой магнитной проницаемостью и имеющих большую площадь поперечного сечения, влияние поверхностного эффекта оказывается значительным. Активное сопротивление рельсов превышает сопротивление постоянному току в 5—10 раз и зависит от протекающего тока.
Имеется несколько формул для определения активного сопротивления рельсов. Для примера приводим формулу, по которой приближенно можно определить активное сопротивление рельсов однопутного участка,

где n.ст— количество стыков на 1 км пути.
Индуктивное сопротивление х тяговой сети при переменном токе обусловлено индуктивностью и взаимной индуктивностью контактной сети и ходовых рельсов. Значение его зависит в основном от взаимного расположения проводов контактной сети и рельсов и в меньшей степени от материала и формы проводника.
Полное сопротивление 1 км тяговой сети

Как определить сопротивления линии — Инженер ПТО

Линии электросетей обладают активными и индуктивными сопротивлениями и активными и емкостными проводимостями, равномерно распределенными по их длине.

В практических электрических расчетах электросетей принято равномерно распределенные постоянные линии заменять сосредоточенными постоянными: активным r и индуктивным х сопротивлениями и активной g и емкостной b проводимостями. Соответствующая этому условию П-образная схема замещения линии приведена на рис. 1,а.

При расчетах местных электросетей напряжением 35 кв и ниже проводимости g и b можно не учитывать и применять более простую схему замещения, состоящую из последовательно соединенных активного и индуктивного сопротивлений (рис. 1,б).

Активное сопротивление линии определяют по формуле

где l— длина провода, м; s — сечение провода или жилы кабеля, ммг γ — удельная расчетная проводимость материала, м/ом-мм2.

Рис. 1. Схемы замещения линий: а — для районных электросетей; б — для местных электросетей.

Среднее расчетное значение удельной проводимости при температуре 20° С для однопроволочных и многопроволочных проводов с учетом их фактического сечения и увеличения длины при скрутке многопроволочных проводов равно для меди 53 м/ом∙мм2, для алюминия 32 м/ом∙мм2.

Активное сопротивление стальных проводов непостоянно. При увеличении тока по проводу возрастает поверхностный эффект, а следовательно, увеличивается активное сопротивление провода. Активное сопротивление стальных проводов определяют по экспериментальным кривым или таблицам в зависимости от величины протекающего по ним тока.

Индуктивное сопротивление линии. Если линия трехфазного тока выполнена с перестановкой (транспозицией) проводов, то при частоте 50 гц индуктивное сопротивление фазы на 1 км длины линии можно Определить по формуле

где: аср – среднее геометрическое расстояние между осями проводов

а1, а2 и а3 — расстояния между осями проводов разных фаз, d — наружный диаметр проводов, принимаемый по таблицам ГОСТ на провода; μ— относительная магнитная проницаемость металла провода; для проводов из цветного металла μ=1; х’0 — внешнее индуктивное сопротивление линии, обусловленное магнитным потоком вне провода; х»0 — внутреннее индуктивное сопротивление линии, обусловленное магнитным потоком, замыкающимся внутри провода.

Индуктивное сопротивление линии длиной l км

Индуктивные сопротивления х0 воздушных линий с проводами из цветного металла составляют в среднем 0,33—0,42 ом/км.

Линии напряжением 330—500 кв для снижения потерь на корону (см. ниже) выполняют не одним многопроволочным проводом большого диаметра, а двумя-тремя сталеалюминиевыми проводами на фазу, расположенными на небольшом расстоянии друг от друга. При этом индуктивное сопротивление линии существенно снижается. На рис. 2 показано подобное выполнение фазы линии 500 кв, где три провода расположены по вершинам равностороннего треугольника со сторонами 40 см. Провода фазы скреплены несколькими жесткими растяжками в пролете.

Применение нескольких проводов на фазу эквивалентно увеличению диаметра провода, что ведет к уменьшению индуктивного сопротивления линии. Последнее можно подсчитать по второй формуле, разделив второй член ее правой части на п и подставив вместо наружного диаметра d провода эквивалентный диаметр dэ определенный по формуле

где n — число проводов в одной фазе линии; асp—среднее геометрическое расстояние между проводами одной фазы.

При двух проводах на фазу индуктивное сопротивление линии снижается примерно на 15—20%, а при трех проводах—на 25—30%.

Суммарное сечение проводов фазы равно необходимому расчетному сечению, последнее как бы разделяют на два-три провода, поэтому такие линии принято условно называть линиями с расщепленными проводами.

Стальные провода обладают значительно большей величиной х0, так как магнитная проницаемость стали больше единицы и определяющим является второй член второй формулы, т. е. внутреннее индуктивное сопротивление х»0.

Рис. 2. Подвесная гирлянда с тремя расщепленными проводами одной фазы линии 500 кв.

Вследствие зависимости магнитной проницаемости стали от величины протекающего по проводу тока определение х»0 стальных проводов достаточно сложно. Поэтому в практических расчетах определяют х»0 стальных проводов по кривым или таблицам, полученным экспериментальным путем.

Индуктивные сопротивления трехжильных кабелей можно принимать, исходя из следующих средних значений:

• для трехжильных кабелей 35 кв — 0,12 ом/км

• для трехжильных кабелей 3—10 кв — 0,07—0,03 ом/км

• для трехжильных кабелей до 1 кв — 0,06—0,07 ом/км

Активная проводимость линии определяется потерями активной мощности в ее диэлектриках.

В воздушных линиях всех напряжений потери через изоляторы невелики даже в районах с сильно загрязненным воздухом, поэтому их не учитывают.

В воздушных линиях напряжением 110 кв и выше при определенных условиях возникает коронирование проводов, обусловленное интенсивной ионизацией окружающего провод воздуха и сопровождающееся фиолетовым свечением и характерным потрескиванием. Особенно интенсивно провода коронируют в сырую погоду. Наиболее радикальным средством снижения потерь мощности на корону является увеличение диаметра провода, так как с увеличением последнего напряженность электрического поля, а следовательно, и ионизация воздуха вблизи провода уменьшаются.

Для линий 110 кв диаметр провода из условий короны должен быть не менее 10— 11 мм (провода АС-50 и М-70), для линий 154 кв — не менее 14 мм (провод АС-95), а для линии 220 кв — не менее 22 мм (провод АС-240).

Потери активной мощности на коронирование в проводах воздушных линий 110—220 кв при указанных и больших диаметрах проводов незначительны (десятки киловатт на 1 км длины линии), поэтому в расчетах их не учитывают.

В линиях 330 и 500 кв применяют два или три провода на фазу, что, как указывалось ранее, эквивалентно увеличению диаметра провода, вследствие чего напряженность электрического поля вблизи проводов значительно снижается и провода коронируют незначительно.

В кабельных линиях 35 кв и ниже потери мощности в диэлектриках малы и их также не учитывают. В кабельных линиях 110 кв и выше потери в диэлектрике составляют несколько киловатт на 1 км длины.

Емкостная проводимость линии обусловлена емкостью между проводами и между проводами и землей.

С достаточной для практических расчетов точностью емкостную проводимость трехфазной воздушной линии можно определять по формуле

где С0 — рабочая емкость линии; ω — угловая частота переменного тока; аср и d — см. выше.

При этом не учитывают проводимость почвы и глубину возврата тока в земле и предполагают, что на линии выполнена перестановка проводов.

Для кабелей рабочую емкость определяют по заводским данным.

Проводимость линии длиной l км

Наличие емкости в линии обусловливает протекание емкостных токов. Емкостные токи опережают на 90° соответствующие фазные напряжения.

В действительных линиях с равномерно распределенными по длине постоянными емкостные токи неодинаковы вдоль длины линии, так как напряжение вдоль линии непостоянно по величине.

Емкостный ток в начале линии в предположении постоянного по величине напряжения

где Uф—фазное напряжение линии.

Емкостная мощность линии (мощность, генерируемая линией)

где U — междуфазное напряжение, кв.

Из третьей формулы следует, что емкостная проводимость линии мало зависит от расстояния между проводами и диаметра проводов. Мощность, генерируемая линией, сильно зависит от напряжения линии. Для воздушных линий 35 кв и ниже она весьма мала. Для линии 110 кв длиной 100 км Qc≈З Мвар. Для линии 220 кв длиной 100 км Qc≈13 Мвар. Наличие расщепленных проводов увеличивает емкость линии.

Емкостные токи кабельных сетей учитывают только при напряжениях 20 кв и выше.

Активные и индуктивные сопротивления линии

Электроснабжение > Выбор сечений по допустимой потере напряжения

АКТИВНЫЕ И ИНДУКТИВНЫЕ СОПРОТИВЛЕНИЯ ЛИНИИ

Активное сопротивление проводов и кабелей из цветных металлов определяется по одной из следующих формул:


где r — расчетное удельное сопротивление провода или жилы кабеля, ом мм2 / м;
g — расчетная удельная проводимость провода или жилы кабеля, м / ом мм2;
F — номинальное сечение провода или кабеля, мм2.
Значения удельного сопротивления и удельной проводимости для медных проводов и кабелей:

для алюминиевых проводов и кабелей

Таблица 5-1 Активные сопротивления проводов и кабелей, ом/км

Сечение провода, мм кв.

Медные провода и кабели

Алюминиевые провода и кабели

Индуктивное сопротивление трехфазной линии с проводами из цветных металлов при частоте переменного тока 50 гц определяется по формуле

где d — внешний диаметр провода, мм;
D — среднее геометрическое расстояние между проводами линии, вычисляемое по формуле

где D — расстояния между проводами у каждой пары проводов трехфазной линии, мм.
Активные сопротивления 1 км провода или жилы кабеля приведены в табл. 5-1, индуктивные сопротивления 1 км линии — в табл. 5-2 и 5-4.
Для стальных проводов активное и внутреннее индуктивное сопротивления зависят от протекающего по проводу переменного тока. Общее индуктивное сопротивление воздушной линии, выполненной стальными проводами, определяется как сумма внешнего х’ и внутреннего х» индуктивных сопротивлений:

Таблица 5-2 Индуктивные сопротивления воздушных линий, ом/км

Среднее геометрическое расстояние между проводами, мм

Для того, чтобы произвести расчет электрической сети на потерю напряжения необходимо знать параметры линий, а именно их сопротивления и проводимости. Если производятся расчеты цепей постоянного тока, то вполне достаточно знать только омическое сопротивление линии. А вот при расчете линии переменного тока одного омического сопротивления бывает недостаточно, и помимо активных сопротивлений, необходимо знать еще индуктивные сопротивления и емкостные проводимости проводов и кабелей.

Активное сопротивление проводов и кабелей

Из электротехники известно, что полное сопротивление при равных условиях переменному и постоянному току будут отличаться. Касается это также проводов и кабелей. Это вызвано тем, что переменный ток распределяется по сечению неравномерно (поверхностный эффект). Однако для проводов из цветных металлов и с частотой переменного напряжения 50 Гц этот эффект не оказывает слишком большого влияния и им можно пренебречь. Таким образом, при расчете проводников из цветных металлов, их сопротивления переменному и постоянному току принимаются равными.

На практике активное сопротивление медных и алюминиевых проводников рассчитывают по формуле:

Где: l – длина в км, γ – удельная проводимость материала провода м/ом∙мм 2 , r – активное сопротивление 1 км провода на фазу Ом/км, s – площадь поперечного сечения, мм 2 .

Величина r, как правило, берется из таблиц справочников.

На активное сопротивление провода влияет и температура окружающей среды. Величину r при температуре Θ можно определить по формуле:

Где: α – температурный коэффициент сопротивления; r20 – активное сопротивление при температуре 20 0 С, γ20 – удельная проводимость при температуре в 20 0 С.

Стальные провода обладают значительно большими активными сопротивлениями, чем аналогичные провода из цветных металлов. Его увеличение обусловлено значительно меньшей величиной удельной проводимости и поверхностным эффектом, который у стальных проводов выражен гораздо более ярко, чем у алюминиевых или медных. Более того, в стальных проводах присутствуют потери активной энергии на вихревые токи и перемагничивание, что в схемах замещения линий учитывают дополнительной составляющей активного сопротивления.

Активное сопротивление стальных проводов (в отличии от проводов из цветных металлов) сильно зависит от величины протекаемого тока, поэтому использовать постоянное значение удельной проводимости при расчетах нельзя.

Активное сопротивление стальных проводов в зависимости от протекающего тока аналитически выразить весьма трудно, поэтому для его определения используют специальные таблицы.

Индуктивное сопротивление проводов и кабелей

Для определения индуктивного сопротивления (обозначается Х) кабельной или воздушной линии определенной протяженности в километрах удобно пользоваться выражением:

Где: Х – индуктивное сопротивление одного километра провода или кабеля на фазу, Ом/км.

Х одного километра воздушной или кабельной линии можно определить по формуле:

Где: Dср – расстояние среднее между проводами или центрами жил кабелей, мм; d – диаметр токоведущей жилы кабеля или диаметр провода, мм; μт – относительная магнитная проницаемость материала провода;

Первый член правой части уравнения обусловлен внешним магнитным полем и называется внешним индуктивным сопротивлением Х / . Из этого выражения видно, что Х / зависит только от расстояния между проводами и их диаметра, а так как расстояние между проводами выбирается исходя из номинального напряжения линии, соответственно Х / будет расти с ростом номинального напряжения линии. Х / воздушных линий больше, чем кабельных. Это связано с тем, что токоведущие жилы кабеля располагаются друг к другу значительно ближе, чем провода воздушных линий.

Где: D1:2 расстояние между проводами.

Для одинарной трехфазной линии при расположении проводов по треугольнику:

При горизонтальном или вертикальном расположении проводов трехфазной линии в одной плоскости:

Увеличение сечения проводов линии ведет к незначительному уменьшению Х / .

Второй член уравнения для определения X обусловлен магнитным полем внутри проводника. Он выражает внутреннее индуктивное сопротивление Х // .

Таким образом выражение для Х можно представить в виде:

Для линий из немагнитными материалов μ = 1 внутреннее индуктивное сопротивление Х // по сравнению с внешним Х / составляет ничтожную величину, поэтому им очень часто пренебрегают.

В таком случае формула для определения Х примет вид:

Для практических расчетов индуктивные сопротивления кабелей и проводов определяют по соответствующим таблицам.

В случае приближенных расчетов можно считать для воздушных линий напряжением 6-10 кВ Х = 0,3 – 0,4 Ом/км, а для кабельных Х = 0,08 Ом/км.

Внутренне индуктивное сопротивление стальных проводов сильно отличается от Х // проводов из цветных металлов. Это вызвано тем, что Х // пропорционально магнитной проницаемости μr, которая сильно зависит от величины тока в проводе. Если для проводов из цветных металлов μr = 1, то для стальных проводов μr может достигать величины в 10 3 и даже выше.

Х // для линий прокладываемых стальными проводами пренебрегать нельзя. Как правило, данную величину берут из таблиц, составленных на основе экспериментальных данных.

Сопротивления r и Х // при некоторых значениях тока могут достигать максимальных значений, а затем с увеличением тока уменьшатся. Это явление объясняется магнитным насыщением стали.

Емкостная проводимость линий

Электрические линии, кроме активного и индуктивного сопротивлений, характеризуются и емкостной проводимостью, которая обусловлена емкостью между проводами и между проводам и землей.

Величину рабочей емкости в трехфазной воздушной линии приближенно можно определить по формуле:

Из данной формулы видно, что рабочая емкость будет увеличиваться с увеличением сечения проводов и уменьшением расстояния между ними. Поэтому при равных сечениях токоведущих частей линии низкого напряжения имеют большую рабочую емкость, чем линии высокого напряжения. В следствии небольших расстояний между токоведущими жилами кабеля и большей диэлектрической проницаемости изоляции по сравнению с воздухом рабочая емкость кабельной линии значительно больше, чем емкость воздушной линии.

Емкостная проводимость одноцепной воздушной линии определяется по формуле:

Определение рабочей емкости кабельной линии по формулам, в которые входят диэлектрическая проницаемость изоляции кабеля, геометрические размеры и другие конструктивные особенности, задача не из легких, поэтому значения рабочей емкости определяют по специальным таблицам, составленным заводом изготовителем для различных марок кабелей, в зависимости от их номинального напряжения.

Емкостной ток вначале линии при холостом ходе (при отключенных электроприемниках) можно определить из формулы:

Где: U – линейное напряжение сети, В; l – длина линии, км;

Емкостные токи имеют серьезное значение в воздушных линиях с рабочим напряжением 110 кВ и выше и в кабельных линиях с напряжением выше 10 кВ. При расчете электрических сетей с напряжениями ниже, чем выше перечисленные, емкость линии могут не учитывать. Емкость токопроводящих частей линии по отношению к земле имеет значение при расчете заземляющих устройств и защиты.

В сети с изолированной нейтралью величину емкостного тока однофазного замыкания на землю приближенно можно определить по формулам:

Активное сопротивление постоянному току

Обусловливает нагрев проводов (тепловые потери) и зависит от мате­риала токоведущих проводников и их сечения. Для линий с проводами не­большого сечения, выполненных цветным металлом (алюминий, медь), ак­тивное сопротивление принимают равным омическому (сопротивлению по­стоянного тока), поскольку проявление поверхностного эффекта при про­мышленных частотах 50-60 Гц незаметно (около 1 %). Для проводов боль­шого сечения (500 мм и более) явление поверхностного эффекта при про­мышленных частотах значительное

Активное погонное сопротивление линии определяется по формуле, Ом/км

(4.2)

где — удельное активное сопротивление материала провода, Ом мм /км; F — сечение фазного провода (жилы), . Для технического алюминия в за­висимости от его марки можно принять = 29,5-31,5 Ом мм /км, для меди = 18,0-19,0 Ом мм 2 /км.

Активное сопротивление не остаётся постоянным. Оно зависит от тем­пературы провода, которая определяется температурой окружающего возду­ха (среды), скоростью ветра и значением проходящего по проводу тока.

Омическое сопротивление упрощённо можно трактовать как препятст­вие направленному движению зарядов узлов кристаллической решётки мате­риала проводника, совершающих колебательные движения около равновесного состояния. Интенсивность колебаний и соответственно омическое со­противление возрастают с ростом температуры проводника.

Зависимость активного сопротивления от температуры провода t опре­деляется в виде

(4. 3)

где— нормативное значение сопротивления R , рассчитывается по формуле (4.2), при температуре проводника t=20°С; а — температурный коэф­фициент электрического сопротивления, Ом/град (для медных, алюминиевых и сталеалюминиевых проводов α = 0,00403, для стальных α = 0,00405).

Трудность уточнения активного сопротивления линий по (4.3) заклю­чается в том, что температура провода, зависящая от токовой нагрузки и ин­тенсивности охлаждения, может заметно превышать температуру окружаю­щей среды. Необходимость такого уточнения может возникнуть при расчёте сезонных электрических режимов.

При расщеплении фазы ВЛ на n одинаковых проводов в выражении (4.2) необходимо учитывать суммарное сечение проводов фазы:

(4.4)

4.2. Индуктивное сопротивление

Обусловлено магнитным полем, возникающим вокруг и внутри про­водника при протекании по нему переменного тока. В проводнике наводится ЭДС самоиндукции, направленная в соответствии с принципом Ленца проти­воположно ЭДС источника


Противодействие, которое оказывает ЭДС самоиндукции изменению ЭДС источника, и обусловливает индуктивное сопротивление проводника. Чем больше изменение потокосцепления,, определяемое частотой то­ка = 2nf (скоростью изменения тока di /dt), и величина индуктивности фазы L, зависящая от конструкции (разветвлённости) фазы, и трёхфазной ЛЭП в целом, тем больше индуктивное сопротивление элемента X =L. То есть для одной и той же линии (или просто электрической катушки) с ростом час­тоты питающего тока f индуктивное сопротивление увеличивается. Естественно, что при нулевой частоте =2nf=0, например в сетях постоянного тока, индуктивное сопротивление ЛЭП отсутствует.

На индуктивное сопротивление фаз многофазных ЛЭП оказывает влияние также взаимное расположение фазных проводов (жил). Кроме ЭДС самоиндукции, в каждой фазе наводится противодействующая ей ЭДС взаи­моиндукции. Поэтому при симметричном расположении фаз, например по вершинам равностороннего треугольника, результирующая противодейст­вующая ЭДС во всех фазах одинаковая, а следовательно, одинаковы пропор­циональные ей индуктивные сопротивления фаз. При горизонтальном распо­ложении фазных проводов потокосцепление фаз неодинаковое, поэтому ин­дуктивные сопротивления фазных проводов отличаются друг от друга. Для достижения симметрии (одинаковости) параметров фаз на специальных опо­рах выполняют транспозицию (перестановку) фазных проводов.

Индуктивное сопротивление, отнесённое к 1 км линии, определяется по эмпирической формуле, Ом/км,

(4.5)

Если принять частоту тока 50 Гц, то при указанной частоте = 2nf = 314 рад/с для проводов из цветных металлов (|m = 1) получим, Ом/км,

Однако для ВЛ указанных номинальных напряжений характерны соот­ношения между параметрами R

(4.23)

где а — расстояние между проводами в фазе, равное 40-60 см.

Анализ зависимости (4.23) показывает, что эквивалентный показывает, что эквивалентный радиус фазы изменяется в диапазоне от 9,3см (при n = 2) до 65 см (при n = 10) и малозависит от сечения провода. Основным фактором, определяющим изменение , является количество проводов в фазе. Так как эквивалентный радиус расщеплённой фазы намного больше действительного радиуса провода нерасщеплённой фазы , то индуктивно

сопротивление такой ВЛ, определяемое по преобразованной формуле вида (4.24), Ом/км, уменьшается:

(4.24)

Снижение Х, достигаемое в основном за счёт уменьшения внешнего сопротивления X ‘ , относительно невелико. Например, при расщеплении фа­зы воздушной линии 500 кВ на три провода — до 0,29-0,30 Ом/км, т. е. при­мерно на треть. Соответственно с уменьшением сопротивления

увеличивается пропускная способность (идеальный предел) линии:

(4.25)

Естественно, что с увеличением эквивалентного радиуса фазы снижается напряжённость электрического поля вокруг фазы и, следователь­но, потери мощности на коронирование. Тем не менее суммарные значения этих потерь для ВЛ высокого и сверхвысокого напряжения (220 кВ и более) составляют заметные величины, учёт которых необходим при анализе режи­мов линий указанных классов напряжений (рис. 4.5).

Расщепление фазы на несколько проводов увеличивает ёмкость ВЛ и соответственно емкостную проводимость:

(4.26)

Например, при расщеплении фазы ВЛ 220 кВ на два провода проводи­мость возрастает с 2,7•10 -6 до 3,5•10 -6 См/км. Тогда зарядная мощность ВЛ 220 кВ средней протяжённости, например 200 км, составляет

что соизмеримо с передаваемыми мощностями по ВЛ данного класса напря­жения, в частности с натуральной мощностью линии

(4.27)

4.6. Схемы замещения линий электропередач

Выше приведена характеристика отдельных элементов схем замещения линий. В соответствии с их физическим проявлением при моделировании электрических сетей используют схемы ВЛ, КЛ и шинопроводов, представленные на рис. 4.5, рис. 4.6, рис. 4.7. Приведём некоторые обобщающие пояснения к этим схемам.

При расчёте симметричных установившихся режимов ЭС схему заме­щения составляют для одной фазы, т. е. продольные её параметры, сопротив­ления Z=R+JX изображают и вычисляют для одного фазного провода (жилы), а при расщеплении фазы — с учётом количества проводов в фазе и эквивалентного радиуса фазной конструкции ВЛ.

Ёмкостная проводимость Вс, учитывает проводимости (ёмкости) между фазами, между фазами и землёй и отражает генерацию зарядной мощности всей трёхфазной конструкции линии:

Активная проводимость линии G, изображаемая в виде шунта между фазой (жилой) и точкой нулевого потенциала схемы (землёй), включает сум­марные потери активной мощности на корону (или в изоляции) трёх фаз:

(4.28)

Поперечные проводимости (шунты) Y=G+jX в схемах замещения можно не изображать, а заменять мощностями этих шунтов (рис. 4.5, б; рис. 4.6, б). Например, вместо активной проводимости показывают потери активной мощности в ВЛ:

(4.29)

или в изоляции КЛ:

(4.30)

Взамен ёмкостной проводимости указывают генерацию зарядной мощ­ности

(4.30а)

Указанный учёт поперечных ветвей ЛЭП нагрузками упрощает оценку электрических режимов, выполняемых вручную. Такие схемы замещения ли­ний именуют расчётными (рис. 4.5, б; рис. 4.6, б).

В ЛЭП напряжением до 220 кВ при определённых условиях можно не учитывать те или иные параметры, если их влияние на работу сети несущест­венно. В связи с этим схемы замещения линий, показанные на рис. 4.1, в ряде случаев могут быть упрощены.

В ВЛ напряжением до 220 кВ потери мощности на корону, а в КЛ на­пряжением до 35 кВ диэлектрические потери незначительные. Поэтому в расчетах электрических режимов ими пренебрегают и соответственно при­нимают равной нулю активную проводимость (рис. 4.6). Учёт активной про­водимости необходим для ВЛ напряжением 220 кВ и для КЛ напряжением 110 кВ и выше в расчётах, требующих вычисления потерь электроэнергии, а для ВЛ напряжением 330 кВ и выше также при расчёте электрических режи­мов (рис. 4.5).

Необходимость учёта ёмкости и зарядной мощности линии зависит от соизмеряемости зарядной и нагрузочной мощности. В местных сетях не­большой протяжённости при номинальных напряжениях до 35 кВ зарядные токи и мощности значительно меньше нагрузочных. Поэтому в КЛ ёмкост­ную проводимость учитывают только при напряжениях 20 и 35 кВ, а в ВЛ ею можно пренебречь.

В районных сетях (110 кВ и выше) со значительными протяжённостями (40-50 км и больше) зарядные мощности могут оказаться соизмеримыми с нагрузочными и подлежат обязательному учёту либо непосредственно (рис. 4.6, б) либо введением ёмкостных проводимостей (рис. 4.6, а).

В проводах ВЛ при малых сечениях (16-35 мм 2 ) преобладают активные сопротивления, а при больших сечениях (240 мм 2 в районных сетях напряже­нием 220 кВ и выше) свойства сетей определяются их индуктивностями. Активные и индуктивные сопротивления проводов средних сечений (50-185 мм 2 ) близки друг к другу. В КЛ напряжением до 10 кВ небольших сече­ний (50 мм 2 и менее) определяющим является активное сопротивление, и в таком случае индуктивные сопротивления могут не учитываться (рис. 4.7, б).

Необходимость учёта индуктивных сопротивлений зависит также от доли реактивной составляющей тока в общей электрической нагрузке. При анализе электрических режимов с низкими коэффициентами мощности (cos

Не нашли то, что искали? Воспользуйтесь поиском:

Лучшие изречения: Для студента самое главное не сдать экзамен, а вовремя вспомнить про него. 10091 — | 7528 — или читать все.

91.146.8.87 © studopedia.ru Не является автором материалов, которые размещены. Но предоставляет возможность бесплатного использования. Есть нарушение авторского права? Напишите нам | Обратная связь.

Отключите adBlock!
и обновите страницу (F5)

очень нужно

Сопротивлением в электротехнике называют такую величину, которая характеризует противодействие отдельность части электрической сети или ее элементов электрическому току. Это основано на том, что сопротивление изменяет электрическую энергию и конвертирует ее в другие типы. Например, в сетях с переменных электротоком происходят необратимые изменения энергии и ее передача между участниками этой электроцепи.

Сопротивление как физическую величину трудно переоценить, так как она является одной из ключевых характеристик электричества в сети и прямо или пропорционально определяет силу тока и напряжение. Этот материал познакомит с такими понятиями как: активное сопротивление и реактивное сопротивление в цепи переменного тока, как проявляется зависимость активного сопротивления от частоты.

Какое сопротивление называется реактивным, какое активным

Активное электросопротивление — это важный параметр электрической сети, который обуславливает превращение электрической энергии, поступающей в участок электроцепи или в отдельный элетроэлемент в любой другой тип энергии: химическую, механическую, тепловую, электромагнитную. Процесс превращения при этом считаю необратимым.

Реактивное сопротивление по-другому называется реактансом и представляет собой сопротивляемость элементов электроцепи, которые вызывается измерением силы электротока или напряжения из-за имеющейся емкости или индуктивности этого элемента. При реактансе происходит обменный процесс между отдельным компонентом сети и источником энергии. Часто это понятие относят к простому электрическому сопротивлению, однако оно отличается некоторыми моментами.

Какие отличия

Отличия этих типов электросопротивления в том, что «внутри» активностного типа энергия не накапливается, так как она попадает в активностый элемент и отдается окружающей среде в виде другого ее типа. Это может быть тепло или механическое поднятие груза, свечение, химическая реакция, задание чему-либо скорости.

Важно! Преданная электроэлементу с активностным электросопротивлением энергия преображается и конвертируется, но не возвращается в сеть.

Сопротивляемость же реактивная, наоборот, копит энергию внутри себя за ¼ всего периода синусоидального электротока, а за следующую четверть возвращает ее обратно в сеть. То есть, в окружающую среду полученная энергия не передается.

В активностном типе фазы электрических токов и напряжения совпадают, следовательно, выделяется некоторое количество электроэнергии. В реактивном виде фазы электротока и напряжения расходятся, поэтому энергия передается обратно. Это во многом объясняет то, что активностные электроэлементы нагреваются, а реактивные — нет.

От чего зависит активное сопротивление

Активное электросопротивление зависит от сечения проводника. Это значит, что полезным сечением при электротоке с высокой частотой будет только тонкий наружный слой проводника. Из этого исходит также то, что активностное электросопротивление только возрастает с увеличением частоты электротока переменного типа.

Для того чтобы уменьшить поверхностный эффект проводника, по которому течет электроток высокой частоты, его изготавливают трубчатым и покрывают напылением металла, хорошо проводящего электрический ток, например, серебром.

В чем измеряется реактивное сопротивление

Само по себе, явление реактанса характерно только для цепей с электрическим током переменного типа. Обозначается оно латинской буквой «X» и измеряется в Омах. В отличие от активностного варианта, реактанс может иметь как положительное, так и отрицательное значение. Знак «+» или «-» соответствует знаку, по которому сдвигается фаза электротока и напряжения. Знак положительный, когда ток отстает от напряжения и отрицателен, когда кот опережает напряжение.

Важно! Абсолютно чистое реактивное электросопротивление имеет сдвиг фазы на ± 180/2. То есть, фаза «двигается» на π/2.

Как правильно измерять сопротивление

При работе с радиоаппаратурой иногда требуется измерять не только активностное, но и реактивное электросопротивление (индуктивность и емкость). Для измерений применяют косвенный метод использования мультиметра, а более точные значения получают при мостовом методе.

Косвенный метод наиболее прост в своей реализации, так как не требует дополнительных схем включения. Одна требуется наличие трех отдельных приборов: амперметра, вольтметра и ваттметра. Если измерить напряжение и силу электротока в цепи, то можно получить полное электросопротивление: Z=U*I После измерения активностной мощности P, можно получить величину активного сопротивления отдельного элемента: R= P/I².

Области проявления

Реактанс электросопротивления проявляется в емкости и индукции. Первое обуславливается наличием емкости проводниках и обмотках или включением в электрическую цепь переменного тока различных конденсаторов. Чем выше емкость потребителя и угловой частоты сигнала электротока, тем меньше емкостная характеристика.

Сопротивляемость, которую оказывает проводник переменному току и электродвижущей силе самоиндукции, называется индуктивным. Оно зависит от индуктивности потребителя. Чем выше его индуктивность и выше частота переменного электротока, тем выше индуктивное электросопротивление. Выражается оно формулой: xl = ωL, где xl — это электросопротивление индукции, L — индуктивность, а ω — угловая частота тока.

Емкостный реактанс электросопротивление проявляется, например, в конденсаторе, который накапливает электроэнергию в виде электромагнитного поля между своими обкладками. Индуктивное электросопротивление можно наблюдать в дросселе, который накапливает энергию в виде магнитного поля внутри своей обмотки.

Активностным же электросопротивлением может обладать любой резистор, линии электропередач, обмотки трансформатора или электрического двигателя.

Таким образом, активный резист и реактанс во многом отличаются друг от друга не только разницей по названию, но и по физическим свойствам. Первый вид превращает электроэнергию в другой вид и отдает ее в окружающую среду. Второй же — возвращает ее обратно в электросеть.

Существуют следующие сопротивления:

1. Омическое сопротивление

2. Активное сопротивление

3. Индуктивное сопротивление

4. Емкостное сопротивление

Индуктивное и емкостное сопротивления являются реактивными, что значит не вызывающими безвозвратных потерь энергии переменного тока.

Омическое сопротивление — это сопротивление цепи постоянному току вызывающее безвозвратные потери энергии постоянного тока.

Единственной причиной вызывающей потери постоянного тока является противодействие материала проводника. На преодоление этого противодействия затрачивается часть энергии постоянного тока, которая превращается в тепловую энергию нагревающую проводник. Эта часть энергии обратно в проводник в виде энергии постоянного тока не возвращается.

На резисторах написана величина их омического сопротивления, т. е. сопротивления постоянному току.

Величина омического сопротивления не зависит от величины тока.

Активное сопротивление — это сопротивление цепи переменному току вызывающее безвозвратные потери энергии переменного тока.

Причины вызывающие безвозвратные потери переменного тока:

-противодействие материала проводника

-вихревые токи (они образуются в сердечниках катушек и нагревают их)

-потери энергии электрического тока за счет перемагничивания сердечника, т. е. на ликвидацию остаточного магнетизма при перемагничивании сердечника

-потери за счет излучения электромагнитной энергии ( любой проводник по которому идет переменный ток излучает электромагнитные волны которые уходят в пространство)

-в радиоаппаратуре провода идут вблизи друг от друга, переменный ток проходя по одному проводу индуктирует токи в близлежащих проводах

Индуктивное сопротивление — это противодействие тока самоиндукции катушки нарастающему току генератора.

На преодоление этого противодействия затрачивается часть энергии переменного тока генератора. Вся эта часть энергии полностью превращается в энергию магнитного поля катушки. Когда ток генератора будет убывать, магнитное поле катушки тоже будет убывать пересекая витки катушки и индуктируя в цепи ток самоиндукции. Теперь ток самоиндукции будет идти в одном направлении с убывающим током генератора. Таким образом вся энергия затраченная током генератора на преодоление противодействия тока самоиндукции катушки полностью вернулась в цепь в виде энергии электрического тока. Поэтому индуктивное сопротивление является реактивным, что значит не вызывающим безвозвратных потерь энергии. Слово реакция обозначает обратное действие.

Емкостное сопротивление — это противодействие электродвижущей силы заряжаемого конденсатора заряду этого конденсатора.

Вся энергия затрачиваемая источником тока на преодоление емкостного сопротивления превращается в энергию электрического поля конденсатора. Когда конденсатор будет разряжаться вся энергия электрического поля вернется обратно в цепь в виде энергии электрического тока. Таким образом емкостное сопротивление является реактивным.

Комментарии могут оставлять только зарегистрированные пользователи

Электрическое сопротивление меди при высоких давлениях и температурах: модель равновесия и образование дефектов кристаллической структуры при ударном сжатии

  • 1.

    Бриш А.А., Тарасов М.С., Цукерман В.А. Электропроводность диэлектриков в сильных ударных волнах. Ж. Эксп. Теор. Физ. 38 (1), 22–25 (1960).

    Google ученый

  • 2.

    Д. Л. Стирис и Г. Э. Дюваль, «Электропроводность материалов при ударном сжатии», High Temp.Высокие давления 2 (5), 477–499 (1970).

    Google ученый

  • 3.

    Р. Н. Килер, «Электропроводность конденсированных сред при высоких давлениях», в сб. Физика высоких плотностей энергии , Под ред. П. Калдирола и Х. Нёпфель (Academic Press, New York, 1971).

    Google ученый

  • 4.

    Якушев В.В. Электрические измерения в динамическом эксперименте // Физ. Мезомех.Горения взрыва 14 (2), 3–19 (1978) [Горение, прим., Ударные волны 14 (2), 131–145 (1978)].

    ADS Google ученый

  • 5.

    Методы исследования свойств материалов при интенсивных динамических нагрузках , Под ред. М. В. Жерноклетов (Институт экспериментальной физики, Российский федеральный ядерный центр, Саров, 2003).

    Google ученый

  • 6.

    Гилев С. Д. Измерение электропроводности конденсированных веществ в ударных волнах (обзор) // Физ. Мезомех. Горения взрыва 47 (4), 3–23 (2011) [Горение, прим., Ударные волны 47 (4), 375–393 (2011)].

    Google ученый

  • 7.

    Дж. Э. Вонг, Р. К. Линде и П. С. Де Карли, «Динамическое электрическое сопротивление железа: свидетельство новой фазы высокого давления», Nature 219 , 713 (1968).

    ADS Статья Google ученый

  • 8.

    Павловский М. Н. Электросопротивление иттербия ударно-сжатого // Журн. Эксп. Теор. Физ. 73 (1), 237–245 (1977).

    Google ученый

  • 9.

    W. J. Nellis, S. T. Weir, A. C. Mitchell, «Минимальная металлическая проводимость жидкого водорода при 140 ГПа (1,4 Мбар)», Phys. Ред. B 59 (5), 3434–3449 (1999).

    ADS Статья Google ученый

  • 10.

    Мочалов М.А., Глуходедов В.Д., Киршанов С.И., Лебедева Т.С. Электропроводность жидких аргона, криптона и ксенона при ударном сжатии до давления 90 ГПа // Ударное сжатие конденсированных сред. . М. Д. Ферниш, Л. К. Чабильдас и Р. С. Хиксон (AIP Press, 2000), стр. 983–986. (AIP Conf. Proc., Vol. 505.)

  • 12.

    Гилев С.Д., Трубачев А.М. Металлизация кремния в ударной волне: порог металлизации и сверхвысокие плотности дефектов // Журн. Физ. Matter 16 (46), 8139–8153 (2004).

    ADS Google ученый

  • 13.

    Гилев С.Д., Прокопьев В.С. Электросопротивление меди при ударном сжатии: экспериментальные данные // ФММ.Горения взрыва 52 (1), 121–130 (2016) [Горение, прим., Ударные волны 52 (1), 107–116 (2016)].

    Google ученый

  • 15.

    Дж. М. Зиман, Электроны и фононы: теория явлений переноса в твердых телах (Кларендон, 1960).

  • 16.

    Гурвич М. Критерий Иоффе-Регеля и удельное сопротивление металлов // Физ. Мезомех. Ред. B 24 (12), 7404–7407 (1981).

    ADS Статья Google ученый

  • 17.

    А. Эйлинг и Дж. С. Шиллинг, «Зависимость удельного электрического сопротивления Pb и Sn от давления и температуры в диапазоне от 1 до 300 К и от 0 до 10 ГПа — использование в качестве монитора давления постоянного сопротивления, точного в широком диапазоне температур; Сверхпроводимость под давлением в Pb, Sn и In », J. Phys. Ф .: Металл. Phys. 11 , 623–639 (1981).

    ADS Статья Google ученый

  • 18.

    А. В. Лоусон, «Влияние гидростатического давления на удельное электрическое сопротивление металлов», Prog. Встретились. Phys. 6 , 1–44 (1956).

    Артикул Google ученый

  • 19.

    Ф. Н. Пу, Й. З. Дин и К. К. Го, «Зависимость электрического сопротивления железа, никеля и меди от давления», Science in China (Scientia Sinica), Ser.A: Math., Phys., Astron. 36 (3), 333–337 (1993).

    Google ученый

  • 20.

    Гилев С. Д. Малопараметрическое уравнение состояния меди // ФММ. Горения Взрыва 54 (4), 107–122 (2018) [Горение, прим., Ударные волны 54 (4), 482–495 (2018)].

    Google ученый

  • 21.

    Р. А. Матула, «Удельное электрическое сопротивление меди, золота, палладия и серебра», J.Phys. Chem. Ref. Данные 8 (4), 1147–1298 (1979).

    ADS Статья Google ученый

  • 22.

    О.А. Шматко, Ю. Усов, Электрические и магнитные свойства металлов и сплавов: Справочник (Киев, Наукова думка, 1987).

    Google ученый

  • 23.

    Физические величины: Справочник , Под ред.Григорьева И.С., Мейлихова Э. З. (М .: Энергоатомиздат, 1991).

    Google ученый

  • 24.

    Трунин Р.Ф., Гударенко Л.Ф., Жерноклетов М.В., Симаков Г.В., Экспериментальные данные по сжатию ударных волн и адиабатическому расширению конденсированных сред (Ин-т эксп. Физики, Российский федеральный ядерный центр, Саров, 2006) [на русском].

    Google ученый

  • 25.

    Р. Г. МакКуин, С. П. Марш, Дж. У. Тейлор и др., «Уравнение состояния твердых тел по результатам исследований ударных волн», в Явления высокоскоростного удара , Под ред. Р. Кинслоу (Academic Press, Нью-Йорк, 1970).

    Google ученый

  • 26.

    А. К. Митчелл и Р. Н. Килер, «Электропроводность меди и алюминия при высоких температурах и давлениях», в: Megagauss Technology and Pulsed Power Applications, Proc.4-й Int. Конф. on Megagauss Magnetic Fields and Related Topics, Santa Fe, 1986 , Ed. К. М. Фаулер, Р. С. Кэрд и Д. Дж. Эриксон (Plenum Press, Нью-Йорк-Лондон, 1987), стр. 317–321.

    Google ученый

  • 27.

    Ян Би, Хуа Тан и Фуцянь Цзин, «Электропроводность железа при ударном сжатии до 200 ГПа», J. Phys .: Condens. Иметь значение. 14 , 10849–10854 (2002).

    ADS Google ученый

  • 28.

    Молодец А. М., Голышев А. А. Теплопроводность индия при высоких давлениях и температурах ударного сжатия // Физ. Мезомех. Телевидение. Tela 51 (2), 213–216 (2009).

    Google ученый

  • 29.

    А. А. Голышев, Д. В. Шахрай, В. В. Ким и др. «Высокотемпературное сопротивление ударного жидкого натрия при давлениях до 230 ГПа», Физ. Ред. B 83 094114 (2011).

    ADS Статья Google ученый

  • 30.

    Х. Гоми, К. Охта, К. Хиросе и др., «Высокая проводимость железа и тепловая эволюция ядра Земли», Phys. Планета Земля. Int. 224 , 88–103 (2013).

    ADS Статья Google ученый

  • 31.

    Кормер С. Б. Оптические исследования ударно-сжатых диэлектриков // Успехи химии. Физ. 1968. Т. . 94. (4). С. 641–687.

    Артикул Google ученый

  • 32.

    Р. А. Грэм, Твердые тела при ударном сжатии под высоким давлением (Springer-Verlag, Нью-Йорк, 1993).

    Google ученый

  • 33.

    Дж. Дж. Дик и Д. Л. Стирис, «Удельное электрическое сопротивление серебряных фольг при одноосном ударно-волновом сжатии», J. Appl. Phys. 46 (4), 1602–1617 (1975).

    ADS Статья Google ученый

  • 34.

    Х. К. Вантин, Л.М. Эриксон и Дж. А. Янзен, «Калибровка манганина с поправкой на гистерезис при ударной нагрузке», J. Appl. Phys. 51 (4), 1957–1962 (1980).

    ADS Статья Google ученый

  • 36.

    Физическое металловедение, перераб. И дополн. , изд.Р. В. Кан и П. Хаасен (Амстердам, 1983).

  • Медь Vs. Silver Wire Conductivity

    Электропроводка — ключевой компонент во всем, от энергетики, телекоммуникаций, бытовой электроники и даже самых простых схемотехнических работ. В основе электрических проводов лежат проводящие металлы, которые позволяют электричеству передаваться от точки к точке: наиболее проводящим из всех является серебро, за которым следует медь. Но, несмотря на то, что серебро считается самым проводящим металлом на Земле, медь является мировым стандартом в электромонтажных работах.Хотя серебряная проволока имеет более высокую проводимость, ее использование имеет недостатки, которые делают медную проволоку лучшим вариантом в большинстве ситуаций.

    TL; DR (слишком длинный; не читал)

    Хотя серебряный провод примерно на 7 процентов более проводящий, чем медный провод той же длины, серебро является значительно более редким металлом, чем медь. В сочетании со склонностью серебра к окислению и потере эффективности в качестве электрического проводника относительно небольшое увеличение проводимости делает медь более разумным вариантом в большинстве сценариев.Серебряная проволока, однако, обычно используется для более чувствительных систем и специальной электроники, где приоритетом является высокая проводимость на небольшом расстоянии.

    Основы проводимости

    Электропроводность — это мера того, насколько хорошо электрический ток течет через данный материал. Чем более проводящим является данный материал, тем меньше электроэнергии будет теряться при прохождении тока от точки к точке, что делает высокую проводимость критически важной для проводов, по которым ток проходит на значительные расстояния. 6 сименс / метр. Измеренная в омах, разница в сопротивлении (количество электричества, теряемого при прохождении тока от точки A к точке B через материал) серебряного и медного провода 24-го калибра длиной 1000 футов является незначительной. Сопротивление медного провода всего на 2 Ом больше.

    Окисление и редкость металла

    Хотя разница в характеристиках серебряной и медной проволоки очевидна, есть несколько причин, по которым медная проволока используется чаще, чем серебряная. Наиболее заметным является обилие меди по сравнению с серебром.Меди природного происхождения на Земле значительно больше, чем серебра, что делает производство более редкого и высокопроизводительного металла значительно более дорогим. Серебро также более подвержено эффектам окисления, особенно во влажном климате или сильно кислых почвах. Проводящие металлы (за функциональным исключением золота) реагируют на воду, кислород и / или серу и со временем разлагаются на полупроводники, становясь гораздо менее эффективными в перемещении электричества. В то время как все металлические провода со временем изнашиваются, высокая скорость разрушения серебра по сравнению с его стоимостью делает его плохим вариантом проводки во многих сценариях.

    Использование металла

    В результате более высокой стоимости серебра серебряная проволока и припой являются нишевым продуктом. В то время как медь используется в проводах, соединителях, печатных схемах и других электрических деталях во многих отраслях промышленности, серебро обычно используется в качестве компонента в специальной электронике и чувствительных системах, таких как промышленные переключатели и автомобильные контакты.

    Активированная медью двухкомпонентная система взаимодействует с устойчивостью к цинку и имипенему у Pseudomonas aeruginosa

    РЕФЕРАТ

    Было исследовано влияние меди (Cu) на устойчивость к микроэлементам и антибиотикам Pseudomonas aeruginosa .Обработка медью индуцировала устойчивость не только к этому металлу, но также, что удивительно, к цинку (Zn). Количественная обратная транскрипция-ПЦР (qRT-PCR) показала, что после обработки Cu транскрипция оперона двухкомпонентной системы (TCS) czcRS была усилена, а также оперона czcCBA , кодирующего эффлюксный насос, специфичный для цинка, кадмий и кобальт. Обработка Cu в то же время вызвала снижение продукции порина OprD, что привело к устойчивости к карбапенемному антибиотику имипенему.Регулятор CzcR, как известно, подавляет oprD . Однако Cu все еще была способна снижать продукцию OprD и индуцировать устойчивость к имипенему у нокаут-мутанта czcRS . Это убедительно свидетельствует о том, что другая Cu-зависимая регуляторная система действует отрицательно на экспрессию oprD . Было показано, что гены-регуляторы TCS copR-copS участвуют в толерантности к Cu у P. aeruginosa . qRT-PCR показала, что избыточное производство CopR или регулятора CzcR привело к усилению транскрипции гена czcC , а также к снижению транскрипции гена oprD либо в штамме дикого типа, либо в штамме czcRS нокаут-мутант.Эксперименты по перепроизводству предполагают, что на посттранскрипционном уровне действует металл-зависимый механизм, контролирующий выработку оттокного насоса CzcCBA. Это исследование показывает, что CopR является новым негативным регулятором порина OprD и что он связывает устойчивость к Zn, Cu и имипенему, взаимодействуя с CzcRS TCS.

    Цинк (Zn) и медь (Cu) необходимы в следовых количествах для роста бактерий. Их гомеостаз необходимо строго регулировать, потому что они токсичны, когда присутствуют в избытке.Zn связывается со свободными тиоловыми группами, влияя на функцию белка (4). Cu проявляет свою токсичность, генерируя активные формы кислорода через Cu-опосредованный окислительно-восстановительный цикл. Он также связывается с сульфгидрильными группами, особенно в форме Cu (I) (35). Оба металла также являются основными загрязнителями окружающей среды, содержащими следы металлов. Бактерии имеют несколько механизмов, позволяющих им процветать в среде, загрязненной токсичными металлами. Активное истечение катионов металлов является ключевым аспектом сопротивления. Предыдущие исследования показали, что отток координируется сетью различных семейств транспортеров, включая системы CBA, которые опосредуют отток, управляемый протонами, АТФазы P-типа и посредники диффузии катионов (25).

    Pseudomonas aeruginosa , грамотрицательная бактерия, представляет собой чрезвычайно универсальный организм, который растет во многих разнообразных наземных, морских и пресноводных средах обитания. Это также условно-патогенный микроорганизм, часто встречающийся в больнице, вызывающий тяжелые инфекции у пациентов с ослабленным иммунитетом и пациентов с муковисцидозом (32). P. aeruginosa характеризуется высоким уровнем устойчивости к антимикробным агентам и микроэлементам металлов, что может быть объяснено сочетанием низкой проницаемости внешней мембраны и наличием нескольких насосов для оттока (26).Устойчивость к Cu штамма PAO1 дикого типа P. aeruginosa обусловлена ​​действием АТФазы Cu (I) / Ag (I) P-типа и, возможно, двумя системами оттока резистентных узловых клеток (RND). Также задействована двухкомпонентная система (TCS) CopRS. CopR, по-видимому, является ключевым регулятором устойчивости к Cu (38). Это также важно для активации ptrA (для «репрессора A Pseudomonas типа III») в ответ на сигнал Cu (10). В Escherichia coli (9) мульти-медная оксидаза CueO вовлечена в внутреннюю резистентность к меди.В P. aeruginosa ген pcoA кодирует мульти-медную оксидазу, которая участвует в окислении Fe (II) до Fe (III). Однако его роль в толерантности к меди неясна (16). Внутренняя резистентность к цинку у этой бактерии в основном обусловлена ​​активностью оттокного насоса типа RND, называемого CzcCBA, который находится под контролем TCS CzcRS (11).

    У бактерий ТКС широко используются в качестве систем передачи сигналов в ответ на изменения окружающей среды или стрессы. Классически TCS состоят из расположенной на мембране сенсорной киназы и цитоплазматического регулятора транскрипции.Сенсорный белок аутофосфорилируется по остатку гистидина, как только он связывает свой лиганд. Затем этот фосфат переносится на остаток аспартата на белке-регуляторе, который становится активным для активации транскрипции целевых генов (14). Когда клетки P. aeruginosa обрабатывают Zn, экспрессия оперона czcRS сильно усиливается, что приводит к транскрипционной активации czcCBA (30). В то же время было обнаружено, что индуцированная Zn повышенная продукция регулятора CzcR отрицательно регулирует oprD .Этот ген кодирует специфический порин, OprD, который принадлежит к большому семейству поринов (37). OprD является основным аминокислотно-пептидным каналом и основным путем проникновения карбапенемов, таких как имипенем, у P. aeruginosa (40). Эта корегуляция была ответственна за наблюдаемую перекрестную резистентность между следами металлов и имипенемом антибиотика.

    Экологические и клинические штаммы P. aeruginosa оказались функционально эквивалентными в отношении нескольких клинически значимых свойств (1), что согласуется с высококонсервативным геномом, встречающимся среди таких изолятов (43).Эти данные свидетельствуют о том, что загрязненная цинком окружающая среда может представлять собой резервуар вредных, устойчивых к антибиотикам штаммов Pseudomonas aeruginosa . Такими резервуарами могут быть, например, почвы, на которые наносился загрязненный цинком осадок сточных вод с очистных сооружений. Как и Zn, Cu распространяется в окружающей среде в результате сельскохозяйственных работ. Он используется в качестве фунгицида и часто присутствует в навозе животных. Кроме того, он освобождается от размыва медных труб и крыш.Полевые эксперименты показали, что поправка на Cu в сельскохозяйственных почвах способствует селекции устойчивости к меди и, в дальнейшем, селекции устойчивости к антибиотикам (3). Это побудило нас изучить, приводит ли обработка медью P. aeruginosa к перекрестной устойчивости к антибиотикам. В настоящей статье мы показали, что такие воздействия также вызывают устойчивость к имипенему антибиотика из-за снижения уровня OprD и что CopR является новым регулятором экспрессии гена oprD .Мы также выявили взаимодействие между CopR-CopS TCS, участвующим в устойчивости к Cu у P. aeruginosa (10, 38), и CzcR-CzcS TCS, контролирующим устойчивость к Zn.

    МАТЕРИАЛЫ И МЕТОДЫ

    Бактериальные штаммы и условия роста. Штаммы бактерий, использованные в этом исследовании, перечислены в таблице 1. Среды Лурия-Бертани (LB) (34) и Мюллера-Хинтона (MH) были использованы в качестве твердых сред. Жидкая среда LB использовалась в отсутствие следов металла. Жидкие культуры, содержащие Cu или Zn, были выполнены в минеральной среде с буфером HEPES (21) с добавлением 0.4% глюкозы и 50 мМ натрия HEPES, pH 7,0, вместо трис-буфера. Жидкие культуры выращивали при 37 ° C на роторном шейкере (160 об / мин) в колбах Эрленмейера на 200 мл, содержащих 30 мл минимальной среды.

    ТАБЛИЦА 1.

    Бактериальные штаммы и плазмиды, использованные в этом исследовании

    Определение следов металлов и устойчивости к антибиотикам. Максимально переносимые концентрации (МПК) следов металлов определяли, как описано ранее (30), с небольшими изменениями. Вкратце, 10 мкл культуры 1 с оптической плотностью при 600 нм (OD 600 ) наносили пятнами на агаризованную среду LB, содержащую различные концентрации солей следов металлов.MTC определяются как наивысшие концентрации металлов, при которых наблюдался рост после 48 ч инкубации при 30 ° C. Устойчивость к антибиотикам определяли по методу Кирби-Бауэра следующим образом. Ночную жидкую культуру, выращенную при 37 ° C в среде MH, разводили 1: 500 в 0,9% NaCl и 2 мл суспензии наносили на чашки с агаром MH, содержащие различные концентрации солей следов металлов. Планшет сушили на воздухе и наносили пропитанные антибиотиком диски (Biomérieux). Планшеты инкубировали в течение ночи при 37 ° C.Зоны ингибирования измеряли и сравнивали с таковыми у эталонного штамма PT5.

    ДНК-манипуляции. Чтобы удалить гены czcRS из штамма PT5, мы сгенерировали фрагмент ПЦР длиной 549 п.н., соответствующий промотору, и первые 90 п.н. гена czcR с праймерами OC1 (5′-CG GAATTC GCAACCGTGTCATCATC ), содержащий сайт рестрикции EcoRI (выделен жирным шрифтом), и OC2 (5′-GGCGCG GTCGAC GATGTAGCCG), включая сайт рестрикции SalI. Этот фрагмент был клонирован в плазмиду pKS-Bluescript (Stratagene) в сайтах EcoRI / SalI.Второй фрагмент ПЦР длиной 650 п.н., соответствующий последним 88 п.н. гена czcS , был получен с праймерами SOC3 (5′-ACGC GTCGAC CTACCACGGCGGCCGCGCCG), содержащими сайт рестрикции SalI, и SOC4 (5′-GCC GGTACC GGTCACCAACCAGGCCACCG), содержащий сайт рестрикции KpnI, и клонированный в тот же pKS-Bluescript в сайтах рестрикции SalI / KpnI. Кассету устойчивости к флуоресцентному белку гентамицинового зеленого цвета из плазмиды pPS858 затем выделяли с помощью рестрикционного фермента SalI и добавляли к pKS-Bluescript, содержащему оба фрагмента в сайте рестрикции SalI.Фрагмент ПЦР размером 3 т.п.н. из pKS-Bluescript, содержащий три фрагмента, был получен с использованием праймеров HindIII-Lup (5′-CCC AAGCTT GTAAAACGACGGCCAGTGAAT) и HindIII-Lrp (5′-CCC AAGCTAT AACAGCTATGACCATG, оба содержащие HindIII-Lup). сайт рестрикции и клонировали в расщепленную HindIII плазмиду pEX18Ap. После переноса и гомологичной рекомбинации в штамм PT5 иссечение кассеты гентамицина было выполнено, как описано ранее (13). Полученный штамм Δ czcRS (рис.1) несет делецию 1900 п.н. внутри генов czcRS , что подтверждается ПЦР.

    РИС. 1.

    Карта области czcRS в штамме дикого типа (wt) и в мутанте Δ czcRS . Последний несет делецию 1900 п.н. в локусе czcRS , соединяющую первые 80 нуклеотидов czcR с последними 90 нуклеотидами czcS . Он по-прежнему содержит межгенную область между czcR и czcC , включая промотор czcRS и бокс-область cop .

    Ген, кодирующий белок CopR, амплифицировали с помощью ПЦР с праймерами 122 (5′-CG GAATTC GGTCGGCATGGCCGGC) и 123 (5′-CG GGATCC GGACATCCGCGAGCCG), содержащими сайты EcoRI и BamHI, соответственно. Продукт длиной 750 п.н. клонировали в сайты EcoRI / BamHI pMMB66EH под промотором tac , получая плазмиду pCopR. Плазмиды pCopR и pCzcR (30) были перенесены в P. aeruginosa путем электропорации (7). Затем бактерии культивировали в присутствии 0.1 мМ изопропил-β-d-тиогалактопиранозид (IPTG) для индукции транскрипции гена copR или czcR .

    Вестерн-блоттинг. Культуры выращивали при 37 ° C до OD 600 , равного 1, в минимальной среде или LB. Затем клетки промывали 0,9% NaCl и ресуспендировали в буфере для загрузки геля додецилсульфата натрия (SDS) с концентрацией 2 мг / мл белка и OD 600 , равным 1, что соответствует 0,175 мг / мл белка. Образцы кипятили 5 мин и центрифугировали 10 мин.Десять микрограммов общего белка разделяли на SDS-10% полиакриламидном геле и переносили на нитроцеллюлозные мембраны. Блоты инкубировали с антителами против OprD или против Hsp70 и выявляли хемилюминесценцией. Все инкубации и промывки антител проводили в TBS-T (20 мМ Трис, 137 мМ NaCl, 0,1% Твин 20, pH 7,6) с добавлением 5% сухого молока.

    Анализ ОТ-ПЦР. Для количественной ПЦР с обратной транскрипцией (qRT-PCR) суммарную РНК экстрагировали с использованием раствора для защиты РНК от бактерий и набора RNeasy (QIAGEN, Hildesheim, Germany) в соответствии с инструкциями производителя.Остаточную ДНК удаляли обработкой ДНКазой с использованием 20 ЕД ДНКазы, свободной от РНКазы RQ1 (Promega), с последующей экстракцией фенол-хлороформом. РНК осаждали этанолом и ресуспендировали в воде, свободной от РНКазы. Для синтеза кДНК 1 мкг РНК подвергали обратной транскрипции с использованием случайных гексамерных праймеров и обратной транскриптазы Improm-II (Promega) в соответствии с инструкциями поставщика. Обратную транскриптазу инактивировали инкубацией при 70 ° C в течение 15 мин, и полученные кДНК хранили при -20 ° C до использования.кДНК количественно измеряли на приборе Bio-Rad iCycler с использованием набора Sybr Green Quantitect (QIAGEN, Hildesheim, Германия). Пары праймеров, которые использовались для qRT-PCR, были разработаны с использованием программы primer3 (33) и показаны в таблице 2.

    ТАБЛИЦА 2.

    Праймеры, используемые для qRT-PCR

    РЕЗУЛЬТАТЫ

    Медь индуцирует устойчивость как к меди, так и к цинку. P. aeruginosa . Штамм дикого типа PT5 и два мутантных штамма, пораженных системой оттока CzcCBA (таблица 1), были использованы для исследования P.aeruginosa к меди (Cu) и цинку (Zn). В таблице 3 показано, что штамм PT5 дикого типа становится толерантным к Cu после продолжительной обработки 30 мкМ Cu, о чем свидетельствует увеличение MTC. Совершенно неожиданно такая же обработка Cu также сделала клетки устойчивыми к Zn. У P. aeruginosa толерантность к Zn в основном обусловлена ​​индукцией оперона czcCBA , регулируемого CzcR-CzcS TCS, и специфична для оттока цинка, кадмия и кобальта (11, 30). Cu индуцировала толерантность к Zn путем экспрессии czcCBA , как было выявлено с помощью qRT-PCR.Добавление 30 мкМ Cu в минимальную культуральную среду приводило к усилению регуляции генов czcR и czcS , а также гена czcC , кодирующего белок внешней мембраны оттокного насоса (рис. 2A) (90-, 9- и 130-кратная индукция для генов czcR , czcS и czcC соответственно).

    РИС. 2.

    И Cu, и Zn индуцируют оперон czcCBA и репрессируют экспрессию oprD . (A) Транскрипция генов czcRS , czcC и oprD проанализирована с помощью qRT-PCR в штамме PT5 дикого типа, выращенном в присутствии 300 мкМ ZnCl 2 или 30 мкМ CuCl 2 .Локализация пар праймеров, используемых для амплификации, показана в таблице 2. Количество мРНК представлено относительно штамма PT5, культивированного в отсутствие металла. Эксперименты проводились дважды в двух независимых случаях. Планки погрешностей представляют собой стандартные отклонения двух определений. (B) Иммуноблот-анализ порина OprD на экстракте общего белка штамма PT5, культивируемого в минеральной среде с буфером HEPES, в присутствии возрастающих концентраций (0, 3, 10 и 30 мкМ) ZnCl 2 или CuCl 2 .Блоты подвергали воздействию антител против OprD или Hsp70 (контроль нагрузки).

    ТАБЛИЦА 3.

    Устойчивость к металлам и антибиотикам дикого типа P. aeruginosa PT5 и мутантных штаммов, пораженных в системе оттока CzcCBA a

    Zn (300 мкМ) не вызывает толерантность к Cu (таблица 3). Более того, мутантный штамм с делецией в гене czcA , кодирующем двигатель оттока, показал чувствительность к Zn, как и ожидалось (MTC 5 мМ) (таблица 3).Однако его внутренняя устойчивость к Cu не пострадала, и устойчивость к этому катиону все еще была индуцируемой у этого мутанта. Эти наблюдения ясно показывают, что откачивающий насос CzcCBA не выталкивает Cu.

    Медь, как и цинк, индуцирует устойчивость к карбапенемному антибиотику имипенему. OprD-порин участвует в проникновении основных аминокислот и карбапенемных антибиотиков, таких как имипенем, в клетки P. aeruginosa (40, 41). Индукция czcCBA , вызванная воздействием Zn, привела к перекрестной устойчивости к имипенему из-за снижения продукции OprD (30).Однако устойчивость к следовым металлам не вызвана снижением OprD, поскольку нокаут-мутант oprD проявлял такую ​​же чувствительность к Zn или Cu, что и его родительский штамм, PT5 (30). Более того, избыточная продукция OprD в штамме PT5 дикого типа не влияла на устойчивость к этим металлам (данные не показаны). Мы наблюдали в штаммах PT5 и Δ czcA , что Cu, как и Zn, очень эффективно индуцирует устойчивость к имипенему, в то время как не влияет на чувствительность к ципрофлоксацину (Таблица 3).Слабая устойчивость к имипенему, проявляемая мутантом Δ czcA , культивированным в присутствии Zn (таблица 3), вероятно, была связана с ингибированием роста, вызванным обработкой металлом. Устойчивость к имипенему была связана со снижением экспрессии oprD , как выявлено с помощью qRT-PCR. Уровни мРНК oprD упали до 50% в присутствии 30 мкМ Cu в среде и до 10% после обработки 300 мкМ Zn (рис. 2А).

    Поскольку отрицательные посттранскрипционные процессы наблюдались в экспрессии oprD (18, 19), количество OprD определяли с помощью Вестерн-блоттинга (рис.2Б). Белок OprD не обнаруживался при 10 мкМ Cu или Zn, что объясняет наблюдаемый фенотип устойчивости к имипенему (таблица 3).

    Два регулятора, CzcR и CopR, действуют отрицательно на продукцию OprD. Ранее мы показали, что воздействие Zn на P. aeruginosa вызывает повышенную регуляцию гена-регулятора czcR , что приводит к репрессии экспрессии oprD . таким образом вызывая устойчивость к имипенему (30). Чтобы определить, репрессирует ли Cu этот порин посредством того же регуляторного механизма, мы сконструировали мутант с двойным нокаутом czcR czcS , как показано на рис.1. Как и ожидалось, толерантность к Zn и Zn-индуцированное подавление OprD были отменены в этом мутантном штамме (Таблица 3; Фиг.3). Однако неожиданно снижение OprD сохранялось после воздействия Cu, что приводило к устойчивости к имипенему, что было выявлено измерениями зоны ингибирования и анализом вестерн-блоттинга (таблица 3; фиг. 3). Очевидно, что в присутствии этого следового металла другая система, независимая от регуляторных последовательностей czcR czcS , действует отрицательно на экспрессию oprD .

    РИС. 3.

    Cu способен ингибировать продукцию OprD независимо от регулятора TCS CzcR, контролирующего транскрипцию оперона czcCBA . Иммуноблот-анализ порина OprD на общем белковом экстракте штамма Δ czcRS , культивированного в минеральной среде с буфером HEPES, в присутствии возрастающих концентраций (0, 3, 10 и 30 мкМ) ZnCl 2 или CuCl 2 . Блоты подвергали воздействию антител против OprD или Hsp70 (контроль нагрузки).

    Кандидатом был copR-copS TCS, который, как было показано, участвует в толерантности к Cu P.aeruginosa (10, 38). Было обнаружено, что CopR демонстрирует 73% сходства и 55% идентичности с регулятором CzcR, как было определено путем попарного выравнивания последовательностей. Поэтому мы клонировали регуляторный ген copR под индуцибельным промотором. Избыточная продукция либо CzcR, либо CopR приводила к сильному снижению уровней мРНК oprD как в PT5 дикого типа (фиг. 4A), так и в мутанте Δ czcRS (фиг. 4B). Также была отменена продукция белка OprD (рис.4С). Избыточная продукция обоих регуляторов активировала гены czcC и czcR-czcS (рис. 4A). Однако гиперпродукция CopR не влияла на транскрипцию copS . В целом эти результаты показывают, что регулятор CopR, как и CzcR, отрицательно регулирует oprD и положительно регулирует оперон czcCBA (рис. 5).

    РИС. 4.

    Избыточная продукция регуляторов CzcR и CopR и ее влияние на транскрипцию генов copRS , czcRS , czcC и oprD (A и B) и на продукцию порина OprD (C).Транскрипцию определяли с помощью qRT-PCR в штамме PT5 дикого типа (wt) (A) или в штамме Δ czcRS (B). (C) Иммуноблот-анализ порина OprD на экстракте общего белка тех же двух штаммов. Бактерии культивировали в LB в присутствии 0,1 мМ IPTG для индукции транскрипции гена copR или czcR . Локализация пар праймеров, используемых для амплификаций, показана в таблице 2. Избыточная продукция регуляторов CzcR и CopR была выполнена в обоих штаммах, трансформированных плазмидами pCzcR и pCopR, соответственно.Количество мРНК представлено относительно бактерий, содержащих пустой вектор, экспрессирующий pMMB66EH (контроль). Эксперименты проводились дважды в двух независимых случаях. Планки погрешностей представляют собой стандартные отклонения двух определений.

    РИС. 5.

    Сложные регуляторные цепи связывают устойчивость к Zn и Cu с устойчивостью к имипенему у P. aeruginosa . Zn и Cu индуцируют экспрессию оперонов czcRS и copRS соответственно. Активный фосфорилированный регулятор CzcR индуцирует экспрессию czcCBA , что приводит к устойчивости к цинку, кадмию и кобальту (30).Считается, что устойчивость к Cu обусловлена ​​повышающей регуляцией генов-переносчиков АТФазы P-типа и катионов, способствующих диффузии (38). Регулятор CopR положительно активирует экспрессию генов czcRS и czcCBA , скорее всего, путем связывания с боксом cop , расположенным между этими последовательностями генов (6). Он также активирует ген ptrA , репрессор генов системы секреции типа III (10). OprD-порин, который способствует проникновению основных аминокислот (a.а.), а также антибиотика имипенема строго регулируется. Основные аминокислоты, такие как аргинин, индуцируют экспрессию oprD посредством активатора транскрипции ArgR (27), в то время как салицилат или бензоат оказывают отрицательное действие (28). MexT, положительный регулятор оперона mexEF-oprN , кодирующий оттоком насос, который приводит к устойчивости к антибиотикам, отрицательно регулирует oprD (18). Регуляторы CopR и CzcR также подавляют экспрессию oprD либо напрямую, либо через неопределенный механизм, что приводит к устойчивости к имипенему.

    Коробка cop , скорее всего, отвечает за индуцированную медью регуляцию системы оттока CzcCBA. В Pseudomonas syringae регулятор CopR связывается с коробкой cop , расположенной перед опероном copABCD (22). Сходный бокс cop был идентифицирован в промоторной области гена czcR P. aeruginosa (6). Поэтому весьма вероятно, что регулятор CopR P. aeruginosa связывается с этим боксом cop , активируя транскрипцию генов czcR czcS , что привело к гену оперона czcCBA (рис.2А и 5). Гиперпродукция CopR приводила к усилению регуляции гена czcC у дикого типа, а также в мутантном штамме Δ czcRS (фиг. 4A и B). Избыточное производство в отсутствие сенсорного лиганда, вероятно, привело к нефосфорилированной форме регулятора CopR и привело к толерантности к Cu (Таблица 4). Это свидетельствует о том, что высокие уровни нефосфорилированного CopR могут связываться с боксом cop и напрямую активировать транскрипцию оперона czcCBA (рис.5). Однако после воздействия Cu на мутант Δ czcRS не наблюдалось увеличения толерантности к Zn (таблица 3). Это указывает на то, что в присутствии металла активный фосфорилированный регулятор CopR индуцирует только транскрипцию регуляторных последовательностей czcRS и действует на оперон czcCBA через регулятор CzcR.

    ТАБЛИЦА 4.

    Толерантность к Zn и Cu в штаммах PT5 и Δ czcRS после избыточной продукции белков-регуляторов CzcR и CopR a

    Доказательства посттранскрипционной регуляции системы оттока CzcCBA.Репрессия экспрессии oprD , скорее всего, была вызвана фосфорилированным CzcR в присутствии Cu или Zn (рис.2) и, возможно, нефосфорилированными формами каждого регулятора, поскольку эксперименты по сверхэкспрессии проводились в отсутствие металла (рис. 4A и B). Штаммы, сверхпродуцирующие CzcR или CopR, анализировали на устойчивость к Zn и Cu (таблица 4). Было обнаружено, что высокие уровни (1000-кратная индукция) обоих регуляторов сильно активируют ген czcC как у дикого типа, так и у штамма Δ czcRS (рис.4A и B). Хотя избыточное производство CopR было способно вызвать устойчивость к Cu в штамме PT5 (таблица 4), оно не увеличивало устойчивость к Zn. Избыточное производство CzcR у дикого типа было даже незначительным (таблица 4). Избыточное производство либо CzcR, либо CopR в штамме Δ czcRS увеличивало устойчивость к цинку (таблица 4). Однако устойчивость к металлу была намного ниже, чем ожидалось от очень высоких количеств мРНК czcC (фиг. 4B). Эти результаты предполагают, что присутствие Cu или Zn существенно для функциональной системы CzcCBA и что посттранскрипционный механизм регулирует этот отток.

    ОБСУЖДЕНИЕ

    В P. aeruginosa двухкомпонентная система (TCS) CzcR-CzcS контролирует устойчивость к цинку (Zn) (11, 30), в то время как медь (Cu) -чувствительный TCS, CopR-CopS, отвечает за на сопротивление Cu (10, 38). Наши результаты демонстрируют, что регулятор CopR связывает сопротивление Cu с толерантностью к Zn, активируя оперон czcRS . Связь между двумя отдельными TCS уже описана в E. coli , где CpxA-CpxR TCS действует совместно с EnvZ-OmpR, другим TCS, который регулирует порины OmpF и OmpC (2).В Pseudomonas syringae CopR является белком-активатором транскрипции, который связывается с консервативным доменом ( cop box) в промоторе хромосомного оперона, ответственного за устойчивость к Cu (22). Тот факт, что предполагаемый бокс cop был идентифицирован в P. aeruginosa между регуляторным геном czcR и геном czcC оперона czcCBA (рис. 5) (6), предполагает, что CopR может связываться в эту область и регулируют транскрипцию двух оперонов.

    При избыточном продуцировании в отсутствие следов металла CopR способен напрямую активировать транскрипцию оперона czcCBA , как показывает открытие, что регуляторные последовательности czcR-czcS не были необходимы для индукции (рис. 4B) . Однако у бактерий, подвергшихся воздействию Cu, CopR не активировал непосредственно оперон czcCBA , как показывает Zn-чувствительный фенотип, проявляемый мутантом Δ czcRS (таблица 3). В присутствии Cu большая часть белка CopR предположительно фосфорилировалась (CopR-P) активируемой лигандом сенсорной киназой CopS.Затем CopR-P действовал на czcCBA опосредованно, путем активации оперона czcRS , таким образом увеличивая количество регулятора CzcR (рис. 4A и 5). Возможно, последний был фосфорилирован фосфо-донорами, такими как ацетилфосфат (20), или перекрестным взаимодействием между сенсорной киназой CopS и регулятором CzcR.

    Было обнаружено, что избыточная продукция нефосфорилированных форм (в отсутствие сенсорных лигандов) двух регуляторов, CopR и CzcR, активирует транскрипцию оперонов czcRS и czcCBA (рис.4A и B). Разумным объяснением этого наблюдения является то, что очень высокие уровни нефосфорилированных регуляторов могут активировать транскрипцию этих оперонов. Однако при выращивании в отсутствие металла штамм PT5 дикого типа, сверхпродуцирующий регуляторы CopR и CzcR, не был устойчив к Zn (таблица 4), что указывает на то, что он не обладал функциональной системой оттока CzcCBA. Снижение устойчивости к цинку на 33% наблюдалось даже при избыточном производстве CzcR. Эти результаты убедительно указывают на то, что продукция CzcCBA также регулируется на посттранскрипционном уровне с помощью металл-зависимого механизма.Антисмысловая регуляция или репрессия трансляции уже наблюдалась в случае генов-мишеней TCS. Например, в E. coli два основных порина, OmpC и OmpF, регулируются транскрипционно с помощью TCS EnvZ-OmpR и на посттранскрипционном уровне двумя небольшими РНК, MicC и MicF (5, 23). У P. aeruginosa GacS-GacA TCS положительно активирует гены, воспринимающие кворум, в сочетании с посттранскрипционными регуляторами малых РНК RsmY и RsmZ, а также RsmA, малым РНК-связывающим белком, подавляющим трансляцию (12, 17, 24).Однако нельзя исключать, что большие количества нефосфорилированных регуляторов могут ингибировать трансляцию мРНК czcCBA или другие посттранскрипционные механизмы.

    Физиологическое значение Cu-индуцированной активации оперона czcCBA неясно. Белок CzcA RND специфически участвует в экспорте цинка, кадмия и кобальта (25). Вывод о том, что нокаутная мутация czcA не влияла на толерантность к Cu (таблица 3), согласуется с идеей о том, что система оттока CzcCBA не вытесняет Cu, и с результатами Teitzel et al.(38) приписывают устойчивость P. aeruginosa Cu к АТФазе Cu (I) / Ag (I) P-типа и, возможно, к двум системам оттока при нодуляционных делениях клеток. Так почему же этот насос активируется при лечении медью? Одно из возможных объяснений индукции системы оттока CzcCBA под действием Cu состоит в том, что в присутствии этого следового металла существует потребность в снижении внутриклеточной концентрации Zn. Было обнаружено, что интерактивные токсические эффекты между Cu и Zn синергичны у грамотрицательной бактерии Vibrio fischeri (42).Выделение Zn тогда минимизирует токсические синергетические эффекты двух металлов. Другая гипотеза состоит в том, что индуцированная Cu активация системы CzcCBA может быть частью механизма защиты, включающего множественные ответы на металлический стресс и позволяющего клеткам справляться с загрязненной средой, загрязненной несколькими металлами.

    Порин OprD участвует в захвате основных аминокислот и небольших пептидов, содержащих эти аминокислоты, через внешнюю мембрану P. aeruginosa (41).Помимо этой специфической функции, OprD также играет неспецифическую роль в поглощении небольших соединений, таких как глюконат (15). Присутствие этого порина при выращивании P. aeruginosa в минимальной среде, содержащей глюкозу (рис. 2–4), предполагает, что OprD может иметь еще одну до сих пор неизвестную функцию (и). Существует несколько негативных регуляторных механизмов, действующих на oprD (рис. 5). Он подавляется MexT, индуктором системы оттока MexEF-OprN (18), салицилатом (28), сукцинатом из-за репрессии катаболита (27) и следами металлов через регуляторы ответа CzcR (30) и CopR (данное исследование).С другой стороны, экспрессия oprD сильно индуцируется, когда аргинин и другие аминокислоты служат единственным источником углерода. Индукция, опосредованная аргинином, зависит от регуляторного белка ArgR (27). Множественные системы, участвующие в регуляции экспрессии oprD , предполагают, что он играет решающую роль в росте P. aeruginosa и устойчивости к различным стрессам.

    Какова физиологическая цель корегуляции oprD опероном оттока антибиотиков с широкой специфичностью через MexT и с генами, участвующими в оттоке следов металлов через регуляторы CzcR и CopR? Репрессия oprD , связанная с активацией насосов оттока RND, может быть частью общего механизма, включающего подавление первичного метаболизма и активацию защитных механизмов, чтобы справиться со стрессом, вызванным антибиотиками или большим количеством следов металлов.Такие регуляции наблюдались у P. aeruginosa , подверженных окислительному стрессу (29). С другой стороны, подавление порина OprD может представлять собой более специфический механизм снижения внутриклеточной концентрации основных аминокислот или пептидов, которые могут ингибировать механизмы устойчивости. Общей чертой между регуляторами MexT, CzcR и CopR является то, что все они регулируют транскрипцию оперонов, участвующих в формировании систем оттока RND (18, 30, 38). Вмешательство основных аминокислот или пептидов в эти защитные механизмы вполне вероятно.Действительно, анализ транскриптома ответа P. aeruginosa на окислительный стресс выявил 18-кратное снижение уровней мРНК транспортного белка аргинина / орнитина в клетках, обработанных H 2 O 2 (29). В связи с этим окислительный стресс является основным механизмом токсичности Cu для E. coli (39). Более того, на системы оттока RND P. aeruginosa влияют ингибиторы оттока, содержащие основные аминокислоты, такие как аргинин или орнитин (31).Поэтому разумно предположить, что аргинин или другие основные аминокислоты действуют как или могли быть предшественниками внутриклеточного диаминосодержащего ингибитора оттока.

    Растет озабоченность по поводу загрязнения окружающей среды следами металлов. В пресноводных средах обитания более важным фактором при отборе устойчивых к антибиотикам бактерий, включая условно-патогенные микроорганизмы человека, является воздействие антропогенных металлов, а не антибиотиков (36). In vitro было обнаружено, что Zn дает спонтанные мутанты P.aeruginosa , пораженный сенсорным геном czcS , конститутивно резистентным к имипенему антибиотика (30). Точно так же Cu может продуцировать такие устойчивые штаммы путем мутаций в сенсорном гене copS . Дальнейшие исследования определят, индуцируется ли конститутивная резистентность к регуляции в среде, загрязненной металлами, и представляет ли она новый механизм устойчивости к антибиотикам. Эти исследования будут способствовать оценке роли металлических контаминантов как селективной силы в поддержании и размножении пула детерминант устойчивости к антибиотикам в резервуарах клинически важных микроорганизмов.

    БЛАГОДАРНОСТИ

    Мы благодарим C. Georgopoulos за подарок антител E. coli Hsp70.

    Мы также благодарим Р. Педуцци, У. Бротона и В. Вилди за поддержку и финансовую поддержку.

    СНОСКИ

      • Получено 17 января 2007 г.
      • Принято 12 апреля 2007 г.
    • Авторские права © 2007 Американское общество микробиологии

    СПРАВОЧНИКИ

    1. 1.↵

      , Ф. Рохо и Дж. Л. Мартинес. 1999. Экологические и клинические изоляты Pseudomonas aeruginosa проявляют патогенные и биоразлагаемые свойства независимо от их происхождения. Environ. Microbiol. 1 : 421-430.

    2. 2.↵

      Бэтчелор, Э., Д. Уолтерс, Л. Дж. Кенни и М. Гулиан. 2005. Система стресс-ответа оболочки Escherichia coli CpxA-CpxR регулирует экспрессию поринов OmpF и OmpC. J. Bacteriol.187 : 5723-5731.

    3. 3.↵

      Berg, J., A. Tom-Petersen и O. Nybroe. 2005. Медная поправка на сельскохозяйственную почву отбирает бактериальную устойчивость к антибиотикам в поле. Lett. Appl. Microbiol. 40 : 146-151.

    4. 4.↵

      Блиндауэр, К. А., М. Д. Харрисон, Дж. А. Паркинсон, А. К. Робинсон, Дж. С. Кавет, Н. Дж. Робинсон и П. Дж. Сэдлер. 2001. Металлотионеин, содержащий цинковый палец в кластере из четырех металлов, защищает бактерии от токсичности цинка.Proc. Natl. Акад. Sci. Соединенные Штаты Америки 98 : 9593-9598.

    5. 5.↵

      Chen, S., A. Zhang, L. B. Blyn и G. Storz. 2004. MicC, второй регулятор малой РНК экспрессии белка Omp в Escherichia coli . J. Bacteriol. 186 : 6689-6697.

    6. 6.↵

      Chen, Y. T., H. Y. Chang, C. L. Lu, and H. L. Peng. 2004. Эволюционный анализ двухкомпонентных систем у Pseudomonas aeruginosa PAO1.J. Mol. Evol. 59 : 725-737.

    7. 7.↵

      Чой, К. Х., А. Кумар и Х. П. Швейцер. 2006. 10-минутный метод приготовления высокоэлектрокомпетентных клеток Pseudomonas aeruginosa : применение для переноса фрагментов ДНК между хромосомами и трансформации плазмиды. J. Microbiol. Методы 64 : 391-397.

    8. 8.

      Furste, J. P., W. Pansegrau, R. Frank, H. Blocker, P. Scholz, M.Багдасарян, Э. Ланка. 1986. Молекулярное клонирование области примазы плазмиды RP4 в экспрессирующем векторе tac P. с несколькими диапазонами хозяев. Ген 48 : 119-131.

    9. 9.↵

      Грасс, Г., К. Такали, П. Э. Клебба, Д. Тиме, А. Мюллер, Г. Ф. Вильднер и К. Ренсинг. 2004. Связь между катехолатными сидерофорами и мульти-медной оксидазой CueO в Escherichia coli . J. Bacteriol. 186 : 5826-5833.

    10. 10.№

      Ха, У. Х., Дж. Ким, Х. Бадран, Дж. Цзя, Х. В. Бейкер, Д. Ву и С. Джин. 2004. Индуцибельный ген Pseudomonas aeruginosa , индуцируемый in vivo, кодирует анти-ExsA для подавления системы секреции типа III. Мол. Microbiol. 54 : 307-320.

    11. 11.↵

      Hassan, M. T., L. D. van der, D. Springael, U. Romling, N. Ahmed, and M. Mergeay. 1999. Идентификация кластера генов czr , участвующих в устойчивости к кадмию и цинку у Pseudomonas aeruginosa .Ген 238 : 417-425.

    12. 12.↵

      Хёрлье, К., Ф. Уильямс, С. Хиб, К. Дормонд, Г. Песси, Д. Сингер, М. Камара, П. Уильямс и Д. Хаас. 2004. Положительный контроль скопления, синтеза рамнолипидов и продукции липазы посттранскрипционной системой RsmA / RsmZ в Pseudomonas aeruginosa PAO1. J. Bacteriol. 186 : 2936-2945.

    13. 13.↵

      Хоанг, Т. Т., Р. Р. Каркофф-Швайцер, А.J. Kutchma и H.P.Sweizer. 1998. Система рекомбинации Flp-FRT с широким кругом хозяев для сайт-специфического вырезания хромосомных последовательностей ДНК: применение для выделения немаркированных мутантов Pseudomonas aeruginosa . Ген 212 : 77-86.

    14. 14.↵

      Hoch, J. A., and T. J. Silhavy. 1995. Двухкомпонентное преобразование сигнала. Американское общество микробиологии, Вашингтон, округ Колумбия.

    15. 15.↵

      Хуанг, Х., и Р. Э. Хэнкок. 1993. Генетическое определение селективности субстрата поринового белка внешней мембраны OprD из Pseudomonas aeruginosa . J. Bacteriol. 175 : 7793-7800.

    16. 16.↵

      Хьюстон, У. М., М. П. Дженнингс и А. Дж. Макьюэн. 2002. Мультикоппероксидаза из Pseudomonas aeruginosa — это ферроксидаза, играющая центральную роль в приобретении железа. Мол. Microbiol. 45 : 1741-1750 гг.

    17. 17.№

      Кей, Э., Б. Хумайр, В. Денерво, К. Ридель, С. Шпар, Л. Эберл, К. Вальверде и Д. Хаас. 2006. Две GacA-зависимые малые РНК модулируют реакцию распознавания кворума у ​​ Pseudomonas aeruginosa . J. Bacteriol. 188 : 6026-6033.

    18. 18.↵

      Kohler, T., S.F. Epp, L.K. Curty, and J.C. Pechere. 1999. Характеристика MexT, регулятора системы множественного оттока MexE-MexF-OprN из Pseudomonas aeruginosa .J. Bacteriol. 181 : 6300-6305.

    19. 19.↵

      Колайли, Ф., А. Караденизли, Х. Савли, К. Эрген, О. Хатирназ, Э. Баликчи, Ф. Будак и Х. Вахабоглу. 2004. Влияние карбапенемов на транскрипционную экспрессию генов oprD , oprM и oprN в Pseudomonas aeruginosa . J. Med. Microbiol. 53 : 915-920.

    20. 20.↵

      Mattison, K., R. Oropeza, N.Байерс и Л. Дж. Кенни. 2002. Мутант по сайту фосфорилирования OmpR обнаруживает разные конформации связывания у ompF и ompC . J. Mol. Биол. 315 : 497-511.

    21. 21.↵

      Мергей, М., Д. Нис, Х. Г. Шлегель, Дж. Гериц, П. Чарльз и Ф. Ван Гийсегем. 1985. Alcaligenes eutrophus Ch44 является факультативным хемолитотрофом с плазмидной устойчивостью к тяжелым металлам. J. Bacteriol. 162 : 328-334.

    22. 22.↵

      Миллс, С. Д., К. К. Лим и Д. А. Кукси. 1994. Очистка и характеристика CopR, белка активатора транскрипции, который связывается с консервативным доменом (бокс cop ) в индуцируемых медью промоторах Pseudomonas syringae . Мол. Genet Genet. 244 : 341-351.

    23. 23.↵

      Mizuno, T., M. Y. Chou и M. Inouye. 1984. Уникальный механизм, регулирующий экспрессию генов: ингибирование трансляции комплементарным транскриптом РНК (микРНК).Proc. Natl. Акад. Sci. Соединенные Штаты Америки 81 год : 1966-1970 гг.

    24. 24.↵

      Малкахи, Х., Дж. О’Каллаган, Э. П. О’Грейди, К. Адамс и Ф. О’Гара. 2006. Посттранскрипционный регулятор RsmA играет роль во взаимодействии между Pseudomonas aeruginosa и эпителиальными клетками дыхательных путей человека, положительно регулируя систему секреции типа III. Заразить. Иммун. 74 : 3012-3015.

    25. 25.↵

      Nies, D.H. 2003. Опосредованная оттоком устойчивость к тяжелым металлам у прокариот. FEMS Microbiol. Ред. 27 : 313-339.

    26. 26.↵

      Nikaido, H. 1994. Предотвращение доступа лекарств к бактериальным мишеням: барьеры проницаемости и активный отток. Наука 264 : 382-388.

    27. 27.↵

      Ochs, M. M., C. D. Lu, R. E. Hancock и A. T. Abdelal. 1999. Аминокислотная индукция специфичного для основных аминокислот порина OprD внешней мембраны из Pseudomonas aeruginosa .J. Bacteriol. 181 : 5426-5432.

    28. 28.↵

      Ochs, M. M., M. P. McCusker, M. Bains, R. E. Hancock. 1999. Отрицательная регуляция порина OprD внешней мембраны Pseudomonas aeruginosa , селективная в отношении имипенема и основных аминокислот. Антимикробный. Агенты Chemother. 43 : 1085-1090.

    29. 29.↵

      Пальма, М., Д. ДеЛука, С. Воргалл и Л. Э. Квадри. 2004. Транскриптомный анализ реакции Pseudomonas aeruginosa на перекись водорода.J. Bacteriol. 186 : 248-252.

    30. 30.↵

      Perron, K., O. Caille, C. Rossier, C. Van Delden, J. L. Dumas и T. Kohler. 2004. CzcR-CzcS, двухкомпонентная система, участвующая в устойчивости к тяжелым металлам и карбапенемам у Pseudomonas aeruginosa . J. Biol. Chem. 279 : 8761-8768.

    31. 31.↵

      Renau, T. E., R. Leger, L. Filonova, E. M. Flamme, M. Wang, R. Yen, D. Madsen, D. Griffith, S.Чемберленд, М. Н. Дадли, В. Дж. Ли, О. Ломовская, В. Дж. Уоткинс, Т. Охта, К. Накаяма и Ю. Исида. 2003. Конформационно ограниченные аналоги ингибиторов эффлюксной помпы, которые усиливают активность левофлоксацина в Pseudomonas aeruginosa . Биоорг. Med. Chem. Lett. 13 : 2755-2758.

    32. 32.↵

      Розенфельд, М., Б. В. Рэмси и Р. Л. Гибсон. 2003. Приобретение Pseudomonas у молодых пациентов с муковисцидозом: патофизиология, диагностика и лечение.Curr. Мнение. Pulm. Med. 9 : 492-497.

    33. 33.↵

      Розен С., Скалецкий Х. 2000. Primer3 в WWW для обычных пользователей и программистов-биологов. Методы Мол. Биол. 132 : 365-386.

    34. 34.↵

      Sambrook, J., and D. W. Russell. 2001. Молекулярное клонирование: лабораторное руководство, 3-е изд. Лабораторный пресс Колд-Спринг-Харбор, Колд-Спринг-Харбор, Нью-Йорк.

    35. 35.↵

      Солиоз, М., и Дж. В. Стоянов. 2003. Гомеостаз меди в Enterococcus hirae . FEMS Microbiol. Ред. 27 : 183–195.

    36. 36.↵

      Stepanauskas, R., T.C. Glenn, C.H. Jagoe, R.C. Tuckfield, A.H. Lindell, C.J. King и J.V. McArthur. 2006. Совместная селекция на устойчивость микробов к металлам и антибиотикам в пресноводных микрокосмах. Environ. Microbiol. 8 : 1510-1514.

    37. 37.↵

      Тамбер, С., М. М. Окс и Р. Э. Хэнкок. 2006. Роль нового семейства поринов OprD в поглощении питательных веществ в организме Pseudomonas aeruginosa . J. Bacteriol. 188 : 45-54.

    38. 38.↵

      Тейтцель, Г. М., А. Гедди, С. К. Де Лонг, М. Дж. Кириситс, М. Уайтли и М. Р. Парсек. 2006. Выживание и рост в присутствии повышенного содержания меди: транскрипционное профилирование подвергнутого стрессу меди Pseudomonas aeruginosa . J. Bacteriol. 188 : 7242-7256.

    39. 39.↵

      Tree, J. J., S.P. Kidd, M.P. Jennings и A.G. McEwan. 2005. Чувствительность к меди cueO мутантов Escherichia coli K-12 и биохимическое подавление этого фенотипа. Biochem. Биофиз. Res. Commun. 328 : 1205-1210.

    40. 40.↵

      Trias, J., and H. Nikaido. 1990. Белок D2 внешней мембраны катализирует облегченную диффузию карбапенемов и пенемов через внешнюю мембрану Pseudomonas aeruginosa .Антимикробный. Агенты Chemother. 34 : 52-57.

    41. 41.↵

      Trias, J., and H. Nikaido. 1990. Канал белка D2 внешней мембраны Pseudomonas aeruginosa имеет сайт связывания для основных аминокислот и пептидов. J. Biol. Chem. 265 : 15680-15684.

    42. 42.↵

      Циридис, В., М. Петала, П. Самарас, С. Хаджиспиру, Г. Сакелларопулос и А. Кунголос. 2006. Интерактивное токсическое действие тяжелых металлов и гуминовых кислот на Vibrio fischeri .Ecotoxicol. Environ. Безопасность 63 : 158-167.

    43. 43.↵

      Wolfgang, M.C., B.R. Kulasekara, X. Liang, D. Boyd, K. Wu, Q. Yang, C.G. Miyada и S. Lory. 2003. Сохранение содержания генома и детерминант вирулентности среди клинических и экологических изолятов Pseudomonas aeruginosa . Proc. Natl. Акад. Sci. Соединенные Штаты Америки 100 : 8484-8489.

    Фитопатология 1994 | Клонирование и характеристика генов, обеспечивающих устойчивость к меди в эпифитных штаммах Pseudomonas syringae, активных в отношении нуклеации льда,


    СМОТРЕТЬ СТАТЬЮ

    Генетика

    Клонирование и характеристика генов, придающих устойчивость к меди в эпифитных штаммах, активном по нуклеации льда Pseudomonas syringae . Джон С. Роджерс, ECOSTAT, Incorporated, P.O. Box 237, Highland City, FL 33846; Эллен Кларк (2), Габриэлла Чирвильери (3) и Стивен Э. Линдоу (4). (2) (4) Департамент патологии растений, 147 Хилгард-Холл, Калифорнийский университет в Беркли 94720; (3) Istituto di Patologia Vegetale, Universita Degli Studi di Catania, 95135 Катания, Италия. Фитопатология 84: 891-897. Принято к публикации 26 апреля 1994 г. Авторское право 1994 г. Американское фитопатологическое общество. DOI: 10.1094 / Phyto-84-891.

    Многие эпифитные штаммы Pseudomonas syringae , полученные от бессимптомных растений-хозяев и растений-хозяев, устойчивы к высоким концентрациям ионов меди.Библиотека геномной ДНК одного из таких штаммов, AL513, была сконструирована в векторе клонирования космиды pLAFR3 с широким кругом хозяев. Была идентифицирована космида, обозначенная pCOPR1.1, которая при конъюгировании с чувствительным к меди (Cu s ) штаммом AL487 P. syringae обеспечивала уровни устойчивости к меди, близкие к дикому типу. Фрагмент Pst I размером 6,5 т.п.н. в pCOPR1.1 придает такую ​​устойчивость к меди. Мутагенез инсерционной инактивации этой космиды с репортерным транспозоном Tn 3 -Spice показал, что область приблизительно 5.5 кб, обозначается CoJ, требуется для сопротивления меди. Транскрипционная активность copJ :: Tn 3 -Слияния гена Spice, вставленные в геном P. syringae AL513, с помощью маркерного обменного мутагенеза, индуцировались в течение 3045 минут, когда всего 0,6 ν г Cu 2+ на миллилитр добавляли к питательной среде. Ионы цинка токсичны для этого штамма бактерий при концентрациях более 10 ? г / мл в питательной среде; однако цинк индуцировал copJ при концентрациях менее 1 ν г / мл.Увеличение доли клеток в популяции, которая переносила высокие дозы меди, коррелировало с повышенной транскрипционной активностью copJ. In planta время индукции copJ было примерно в шесть раз больше, чем время индукции in vitro.

    Дополнительные ключевые слова : экспрессия гена.

    Режим действия Группа M1: Медь

    Создание и поддержание хорошей среды выращивания имеет решающее значение для получения урожая высокого качества.У новичков и неопытных гроверов часто возникают многочисленные вопросы о том, какие питательные среды им следует использовать и как добиться максимальной производительности. Даже опытные производители могут столкнуться с проблемами со средой, будь то субстрат, который они использовали в течение многих лет, или что-то новое, с которым они экспериментируют.

    Следует избегать длительного хранения упакованных питательных сред вне помещений. Солнечный свет может разрушить и со временем разрушить пластиковую упаковку. Есть ли у смеси для выращивания срок годности?
    Всегда предпочтительнее использовать как можно более свежую смесь для выращивания, поскольку некоторые химические и физические свойства могут измениться во время хранения.Степень изменения зависит как от времени, так и от условий хранения.

    Будь то мешки, тюки или насыпные, после хранения смесь может высыхать, становясь пыльной и трудной для смачивания. Смесь, хранящаяся на открытом воздухе во влажных дождливых условиях, может впитывать влагу и становиться мокрой и заплесневелой. При транспортировке и заливке влажная смесь легко уплотняется, что приводит к снижению пористости при аэрации. Несмотря на свой неприглядный вид, плесень не является патогенной и быстро проходит сама по себе.

    Большинство смесей содержат стартовые удобрения.По мере того как смеси стареют во время хранения, естественные микроорганизмы могут потреблять часть этого удобрения, снижая электропроводность и содержание азота. Если старая смесь используется вместе со свежей новой смесью, могут наблюдаться некоторые начальные различия в росте, особенно если первое внесение удобрений отложено.

    Солнечный свет может разрушить и в конечном итоге разрушить пластиковые пакеты или тюки, используемые в качестве упаковки, что может привести к заражению семенами сорняков или болезнетворными организмами.Хотя существует множество «а что, если», смеси для выращивания лучше всего использовать в течение шести месяцев после производства.

    2. Уровень pH воды очень высокий. Повлияет ли это на смесь для выращивания и выращиваемые в ней культуры?
    PH воды является мерой кислотности или основности раствора. Легко предположить, что pH поливной воды может влиять на pH растущей смеси. Однако один только pH воды мало влияет на смесь. Напротив, другое свойство воды — уровень щелочности — влияет на pH смеси. Вода с высоким pH может, но не всегда, иметь высокую щелочность и должна побудить производителя провести полный анализ воды для определения уровня щелочности.

    Вода для орошения с высоким содержанием щелочности может вызвать повышение pH растущей смеси, что приведет к дефициту микроэлементов в pH-чувствительных культурах, таких как петуния и калибрахоа. Высокий pH воды, рассматриваемый как единственный фактор, является более важным фактором при приготовлении растворов пестицидов, чем его влияние на растущую смесь.

    Вода с низким pH также может вызвать проблемы. Снижение концентрации бикарбоната в воде с низким pH может вызвать снижение pH растущей смеси, увеличивая вероятность проблем с токсичностью микроэлементов у чувствительных растений, таких как герань и календула.

    3. Есть ли преимущество в использовании кокосового волокна в смеси?
    Койра, полученная из кокосовой шелухи, по своей природе несколько напоминает торф, но есть различия. Поскольку во время полива кокосовое волокно плотнее торфа, смеси для выращивания с высоким содержанием кокосового волокна менее склонны к осаждению сверху горшка, чем торфяные смеси.

    Койр имеет более высокий pH, чем торф. По сравнению с торфом, кокосовое волокно содержит более высокий уровень калия и натрия, что приводит к более высокому уровню растворимых солей.Есть также некоторые свидетельства того, что смеси, содержащие койр, менее подвержены заражению грибными комарами.

    4. Как долго я могу хранить смесь, содержащую удобрения с контролируемым высвобождением?
    Хорошая практика, которой следует придерживаться при выращивании смеси, содержащей удобрения с контролируемым высвобождением, — использовать ее как можно скорее. В обычных составах для тепличного применения каждое удобрение с контролируемым высвобождением имеет коэффициент долговечности или скорость высвобождения, указанный на этикетке (например, от трех до четырех месяцев, 180 дней и т. Д.). Скорость высвобождения зависит от температуры среды во влажной растущей смеси. Чем выше температура, тем быстрее скорость выделения. Поскольку смеси для выращивания содержат некоторое количество влаги, процесс выделения удобрений с контролируемым высвобождением начинается вскоре после их приготовления, что приводит к увеличению уровня растворимых солей.

    Во время хранения скорость высвобождения удобрений зависит от температуры, времени, степени влажности растущей смеси и фактора долговечности удобрения. Хотя любую смесь, содержащую удобрения с контролируемым высвобождением, можно безопасно хранить в течение недели или двух перед использованием, перед использованием смеси следует проверять уровень растворимых солей после длительного хранения.

    При необходимости уровень соли можно снизить путем выщелачивания после наполнения горшков. Лучшая практика управления — заказывать только то количество смеси, которое можно использовать до того, как выщелачивание станет необходимым. Упакованные смеси следует хранить в прохладном и сухом месте, чтобы свести к минимуму высокие температуры и поглощение влаги.

    5. Связывает ли кора азот?
    Все компоненты органических смесей подвергаются естественному разложению. За этот процесс ответственны бактерии и грибки. Микроорганизмы потребляют азот вместе с органическим материалом, и азот становится «связанным» внутри клеточной структуры.В смеси для выращивания эти микроорганизмы конкурируют с растениями за азот. Растущие смеси, изготовленные из легко разлагаемого органического материала, могут поддерживать большую популяцию микроорганизмов.

    Свежая кора, взятая непосредственно с деревьев, быстро разлагается. Чтобы компенсировать это, производители питательных сред выдерживают или компостируют кору. Полученная компостная кора устойчива к дальнейшему быстрому разложению.
    Правильно обработанная сосновая кора важна для производства чистых смесей для выращивания.
    Включение выдержанной или компостированной коры в смесь поддерживает гораздо менее активную популяцию микроорганизмов, чем свежая кора, потребляя или «связывая» меньше азота. Правильно выдержанная или компостированная кора связывает лишь немного больше азота, чем торфяной мох.

    6. Являются ли смеси коры «подавляющими болезни»?
    Состаренная или компостированная кора содержит много видов естественных микроорганизмов. Некоторые из этих микроорганизмов являются родственниками бактерий и грибов, используемых в коммерчески доступных продуктах биоконтроля.При использовании в смеси для выращивания, правильно обработанная кора на короткое время подавляет некоторые болезнетворные микроорганизмы. На эти подавляющие свойства не следует полагаться исключительно для борьбы с болезнями.

    Компоненты смеси, которые обрабатываются должным образом, включая кору, заселяются микроорганизмами, подавляющими определенные грибковые заболевания. Важно отметить, что слово «подавляющее» — это не то же самое, что «предотвращение». Проблемы с болезнями могут возникать в подавляющих смесях в условиях плохой санитарии или тяжелой болезни.Подавляющие смеси следует использовать в качестве средства борьбы с болезнями наряду с обычными фунгицидами и программами санитарии.

    7. Почему pH смеси для выращивания такой низкий при тестировании прямо из пакета?
    Ингредиенты для выращивания сосновой коры и торфа, естественно, имеют низкий pH в диапазоне от 3,5 до 4,5. Чтобы отрегулировать pH до желаемого диапазона от 5,5 до 6,5 для растениеводства, необходимо добавить известняк. Как только контейнеры наполнятся смесью и она увлажнится, известняк начнет реагировать и повышать pH смеси.Однако известняк не реагирует мгновенно; для реакции и последующего повышения pH требуется от трех до пяти дней.

    Свежеприготовленная смесь прямо из мешка может иметь низкий pH, и только после того, как смесь поливается, известняк активируется. По мере старения смеси во время хранения может происходить медленное повышение pH.

    8. На поверхности смеси образовалась зеленая корка. Когда смесь высыхает, накипь становится коричневой и вода не проникает на поверхность.Что вызывает это?
    Рост водорослей приводит к образованию зеленой пены на поверхности растущей смеси. При высыхании пена образует непроницаемый барьер, затрудняющий полив. Водоросли, являющиеся растениями, процветают в теплице. Любая постоянно влажная зона в теплице подвержена росту водорослей.

    Чрезмерный рост водорослей происходит при слишком влажной смеси. Избыточный полив, плохая циркуляция воздуха и / или уплотненная среда для выращивания создают условия, препятствующие высыханию и способствующие росту водорослей.Чтобы свести к минимуму проблемы с водорослями, необходимы надлежащее управление водой и окружающей средой.

    9. Нет ли дефицита торфяных земель в Канаде? Не торфяная
    истощая заболоченные земли?
    Торфяная промышленность Северной Америки очень серьезно относится к проблемам окружающей среды. Например, когда торфяное болото подходит к концу своей продуктивной жизни, в обязательном порядке на этой территории должно быть восстановлено действующее водно-болотное угодье. Эти восстановленные территории могут стать экологически сбалансированными системами в течение 5-20 лет.

    Существует ошибочное представление о дефиците торфа и о неустойчивости урожайности. Торф — это возобновляемый ресурс, который накапливается в 70 раз быстрее, чем его собирают. В Северной Америке имеется более 270 миллионов акров торфяных земель, из которых только около 40 000 акров (0,016 процента) используются для производства торфа. Есть также миллионы акров в национальных парках и других заповедниках, которые никогда нельзя трогать.

    10. Где я могу найти дополнительную информацию об экологических проблемах, связанных с торфяным мхом?
    Веб-сайт Канадской ассоциации сфагнового торфа и мха www.peatmoss.com/index.php содержит множество ресурсов по сбору торфа и окружающей среде.

    Боб Стейнкамп и Майкл Тилли — менеджеры технических служб, Джейми Гибсон — директор по исследованиям и разработкам, а Хью Пул — директор технических служб, Conrad Fafard Inc., Fafard Technical Services, (864) 224-7989, доб. 2382; [email protected]; www.fafard.com.

    Основы электричества: сопротивление, индуктивность и емкость

    Электронные схемы являются неотъемлемой частью почти всех технологических достижений, достигнутых в нашей жизни сегодня.Сразу приходят на ум телевидение, радио, телефоны и компьютеры, но электроника также используется в автомобилях, кухонной технике, медицинском оборудовании и промышленных системах управления. В основе этих устройств лежат активные компоненты или компоненты схемы, которые электронно управляют потоком электронов, например, полупроводники. Однако эти устройства не могли функционировать без гораздо более простых пассивных компонентов, которые предшествовали полупроводникам на многие десятилетия. В отличие от активных компонентов, пассивные компоненты, такие как резисторы, конденсаторы и катушки индуктивности, не могут управлять потоком электронов с помощью электронных сигналов.

    Сопротивление

    Как следует из названия, резистор — это электронный компонент, который препятствует прохождению электрического тока в цепи.

    В металлах, таких как серебро или медь, которые имеют высокую электропроводность и, следовательно, низкое удельное сопротивление, электроны могут свободно переходить от одного атома к другому с небольшим сопротивлением.

    Электрическое сопротивление компонента схемы определяется как отношение приложенного напряжения к электрическому току, протекающему через него, согласно HyperPhysics, веб-сайту физических ресурсов, размещенному на кафедре физики и астрономии Государственного университета Джорджии.Стандартной единицей измерения сопротивления является ом, названный в честь немецкого физика Георга Симона Ома. Он определяется как сопротивление в цепи с током 1 ампер при 1 вольте. Сопротивление можно рассчитать с помощью закона Ома, который гласит, что сопротивление равно напряжению, деленному на ток, или R = V / I (чаще записывается как V = IR), где R — сопротивление, V — напряжение, а I — ток.

    Резисторы обычно делятся на постоянные и переменные. Резисторы с фиксированным значением представляют собой простые пассивные компоненты, которые всегда имеют одинаковое сопротивление в установленных пределах по току и напряжению.Они доступны в широком диапазоне значений сопротивления, от менее 1 Ом до нескольких миллионов Ом.

    Переменные резисторы — это простые электромеханические устройства, такие как регуляторы громкости и переключатели яркости, которые изменяют эффективную длину или эффективную температуру резистора, когда вы поворачиваете ручку или перемещаете ползунок.

    Пример индуктора из медного провода, установленного на печатной плате. (Изображение предоставлено Shutterstock)

    Индуктивность

    Индуктор — это электронный компонент, состоящий из катушки с проволокой, через которую проходит электрический ток, создающий магнитное поле.Единицей измерения индуктивности является генри (H), названный в честь Джозефа Генри, американского физика, который независимо открыл индуктивность примерно в то же время, что и английский физик Майкл Фарадей. Один генри — это величина индуктивности, которая требуется для создания 1 вольт электродвижущей силы (электрического давления от источника энергии), когда сила тока изменяется со скоростью 1 ампер в секунду.

    Одним из важных применений индукторов в активных цепях является то, что они имеют тенденцию блокировать высокочастотные сигналы, пропуская низкочастотные колебания.Обратите внимание, что это противоположная функция конденсаторов. Объединение двух компонентов в цепь может выборочно фильтровать или генерировать колебания практически любой желаемой частоты.

    С появлением интегральных схем, таких как микрочипы, катушки индуктивности становятся все менее распространенными, потому что трехмерные катушки чрезвычайно сложно изготовить в двумерных печатных схемах. По этой причине, по словам Майкла Дубсона, профессора физики из Университета Колорадо в Боулдере, микросхемы разрабатываются без катушек индуктивности и вместо них используют конденсаторы для достижения практически тех же результатов.

    Несколько примеров конденсаторов. Конденсаторы хранят электрический заряд. (Изображение предоставлено Питером Матисом, Университет Колорадо)

    Емкость

    Емкость — это способность устройства накапливать электрический заряд, и поэтому электронный компонент, накапливающий электрический заряд, называется конденсатором. Самый ранний пример конденсатора — лейденская банка. Это устройство было изобретено для накопления статического электрического заряда на проводящей фольге, которая выстилала внутреннюю и внешнюю поверхность стеклянной банки.

    Простейший конденсатор состоит из двух плоских проводящих пластин, разделенных небольшим зазором. Разность потенциалов или напряжение между пластинами пропорционально разнице в количестве заряда на пластинах. Это выражается как Q = CV, где Q — заряд, V — напряжение, а C — емкость.

    Емкость конденсатора — это количество заряда, которое он может хранить на единицу напряжения. Единицей измерения емкости является фарад (Ф), названный в честь Фарадея, и определяется как способность хранить 1 кулон заряда с приложенным потенциалом 1 вольт.Один кулон (C) — это количество заряда, переносимого током в 1 ампер за 1 секунду.

    Для повышения эффективности обкладки конденсатора уложены слоями или намотаны катушками с очень маленьким воздушным зазором между ними. В воздушном зазоре часто используются диэлектрические материалы — изоляционные материалы, которые частично блокируют электрическое поле между пластинами. Это позволяет пластинам накапливать больше заряда без искрения и короткого замыкания.

    Конденсаторы часто встречаются в активных электронных схемах, использующих колебательные электрические сигналы, например, в радиоприемниках и звуковом оборудовании.Они могут заряжаться и разряжаться почти мгновенно, что позволяет использовать их для создания или фильтрации определенных частот в цепях. Колебательный сигнал может заряжать одну пластину конденсатора, в то время как другая пластина разряжается, а затем, когда ток меняется на противоположное, он заряжает другую пластину, в то время как первая пластина разряжается.

    Как правило, более высокие частоты могут проходить через конденсатор, а более низкие частоты блокируются. Размер конденсатора определяет частоту среза, для которой сигналы блокируются или пропускаются.Комбинированные конденсаторы могут использоваться для фильтрации выбранных частот в заданном диапазоне.

    Суперконденсаторы производятся с использованием нанотехнологий для создания сверхтонких слоев материалов, таких как графен, для достижения емкости в 10-100 раз больше, чем у обычных конденсаторов того же размера; но они имеют гораздо более медленное время отклика, чем обычные диэлектрические конденсаторы, поэтому их нельзя использовать в активных цепях. С другой стороны, они иногда могут использоваться в качестве источника питания в определенных приложениях, например, в микросхемах памяти компьютера, чтобы предотвратить потерю данных при отключении основного питания.

    Конденсаторы также являются важными компонентами устройств отсчета времени, например, разработанных компанией SiTime, базирующейся в Калифорнии. Эти устройства используются в самых разных приложениях, от мобильных телефонов до высокоскоростных поездов и торговли на фондовом рынке. Это крошечное устройство синхронизации, известное как МЭМС (микроэлектромеханические системы), для правильной работы полагается на конденсаторы. «Если резонатор [колебательный компонент в устройстве синхронизации] не имеет подходящего конденсатора и емкости нагрузки, схема синхронизации не будет надежно запускаться, а в некоторых случаях она вообще перестает колебаться», — сказал Пиюш Севалия, исполнительный директор. вице-президент по маркетингу в SiTime.

    Дополнительные ресурсы:

    Эта статья была обновлена ​​16 января 2019 г. участницей Live Science Рэйчел Росс.

    Условия, способствующие подземной коррозии меди

    Этот документ является отредактированной версией статьи, опубликованной в журнале American Water Works Association Journal , август 1984 г. и перепечатанной с разрешения American Water Works Association .

    Дж. Р. Майерс
    JRM Associates, 4198 Мерлин Драйв, Франклин, Огайо 45005

    A.Коэн
    Copper Development Association Inc., 260 Madison Ave., New York, NY 10016

    Медь, благородный металл, встречающийся в природе в своей элементарной форме, почти полностью невосприимчив к коррозии, вызываемой почвами во всем мире. Но было бы ошибкой делать вывод о том, что медь не подвержена коррозии. В этой статье описывается множество возможных ситуаций, в которых медные трубы или трубки могут подвергаться внешней коррозии. Эти ситуации подробно обсуждаются, и даются предложения о том, как определить подземную коррозию медных труб без выемки грунта и как смягчить существующие условия коррозии.

    Убеждение знающих инженеров, архитекторов и персонала водоканала в том, что на медь не оказывает негативного воздействия на большинство почв во всем мире, вполне обосновано. Медные артефакты необычной хорошей сохранности продолжают находить в Месопотамии из-под глины, отложенной во время «Великого потопа», который, как полагают, произошел около 4000 г. до н. Э. 1 Многие подземные медные трубы, использовавшиеся для транспортировки воды в Египте почти 5000 лет назад, все еще существуют. Кроме того, медь — один из немногих металлов, который существует как элемент в своей естественной форме.Медные трубы имеют также выдающуюся историю как материал с высокой коррозионной стойкостью в большинстве подземных сред. Однако существуют условия, которые могут вызвать коррозию меди при контакте с определенными почвами. К ним относятся:

    • аномально агрессивные почвы,
    • локализованных и длиннолинейных концентрационных клеток, созданных различиями в составе почвы,
    • действие паразитных постоянных токов (DC), протекающих в земле,
    • с дефектами конструкции и изготовления,
    • определенные условия, создаваемые переменным током (AC),
    • термогайванических эффектов и
    • гальваническое воздействие с участием разнородных материалов.
    Вернуться к началу

    Аномально агрессивные почвы

    Медь практически не подвержена коррозии. В большинстве подземных сред он ведет себя как благородный металл из-за естественной защитной пленки, образующейся на поверхности металла. Если эта пленка, которая часто состоит из красновато-коричневой закиси меди (Cu 2 0), будет разрушена и не подлежит ремонту, медь подвергнется коррозии. К счастью, защитная пленка на меди остается неповрежденной или легко ремонтируется в большинстве почвенных условий.

    Проведены три окончательных исследования подземной коррозии меди. 2-4 Весьма вероятно, что это очевидное отсутствие интереса к коррозии меди со стороны почвы является результатом известной коррозионной стойкости металла в подземных средах.

    Анализ результатов этих трех независимых исследований ясно показывает, что подземная коррозия меди необычайно сложна. В общем, коррозия не может быть напрямую связана с каким-либо одним или даже несколькими факторами, поскольку в ней задействовано множество взаимосвязанных почвенных условий.Данные, представленные в трех исследованиях, и результаты других 5,6 позволяют сделать некоторые предварительные выводы относительно коррозии меди в подземных средах. К ним относятся:

    • Коррозия часто связана с сочетанием повышенного содержания сульфатов или хлоридов в почве в сочетании с плохим дренажем, почвой, обладающей значительной способностью удерживать влагу, и умеренным или сильным годовым количеством осадков (обычно более 76 см [30 дюймов]). ]).
    • Повышенные концентрации сульфатов или хлоридов или того и другого в почве, вероятно, являются основным фактором процесса подземной коррозии, но для поддержания электрохимического воздействия требуется значительная влажность.Сульфаты и хлориды не могут отрицательно повлиять на медь, если выпадают небольшие осадки и достаточный дренаж.
    • Очень низкое удельное сопротивление почвы (т.е. менее 100-500 Ом-см) обычно указывает на то, что почва может быть агрессивной.
    • Почвы, содержащие большое количество органических веществ (особенно почвы, содержащие органические кислоты), могут вызывать коррозию
    • Влажные огарочные засыпки обычно вызывают коррозию либо из-за присутствующих сульфидов, либо из-за гальванического воздействия, создаваемого частицами углерода в огарках
    • Строительный щебень, содержащий значительное количество извести, не должен быть особенно коррозионным, при условии, что ячейки локальной концентрации, особенно ячейки дифференциального кислорода, не образуются во время засыпки
    • Такие почвы, как глина, песок, гравий, суглинок и мел, редко обладают сочетанием свойств, связанных с коррозией
    • Органические почвы, поддерживающие активные анаэробные бактерии (т.е.например, сульфатредуцирующие вещества) могут образовывать сульфиды, агрессивные по отношению к меди
    • Почвы, содержащие неорганические кислоты, могут быть необычно агрессивными по отношению к меди

    Почвы, содержащие значительное количество соединений аммиака, обычно вызывают коррозию меди. Внешний вид медной поверхности и идентификация продуктов коррозии обычно позволяют понять причину ухудшения качества. Например, продуктами коррозии зеленой меди часто являются основной карбонат меди, основной сульфат меди или оксихлориды меди.Присутствие заметных количеств оксихлоридов меди в продуктах коррозии можно было бы ожидать для медной водяной трубы, которая была закопана в приливно-болотной среде с низким удельным сопротивлением. Густой черный слой на меди указывает на присутствие сульфида меди и возможность активности анаэробных бактерий как причины коррозии. Присутствие аммиака в сочетании с сульфатными соединениями на поверхности меди указывает на то, что причиной коррозии могут быть удобрения для газонов.

    Коррозия подземной меди может быть как равномерной, так и локализованной (рисунок ниже).

    Локальная коррозия предполагает наличие ячеек местного действия, например, создаваемых неоднородной засыпкой. Также подозревается местная коррозия электролизера, когда нижняя сторона горизонтальной медно-водяной трубы подвержена преимущественной коррозии.

    Вернуться к началу

    Коррозия ячейки концентрации

    Существует по крайней мере три типа электрохимических концентрационных ячеек, которые вызывают коррозию металла или сплава из-за различий в окружающей среде.К ним относятся кислородные, нейтрально-солевые и водородно-ионные элементы.

    Области на металлической поверхности, контактирующие с почвой, которая имеет повышенное содержание кислорода, обычно будет катодной по сравнению с теми участками, где присутствует меньше кислорода. Кислород обычно действует как катодный деполяризатор; кроме того, участки с повышенным содержанием кислорода, как правило, являются предпочтительными катодными участками, где может происходить восстановление кислорода:

    2H 2 0 + 0 2 + 4e — 40H

    Это обычно называется ячейкой с дифференциальной концентрацией кислорода.Коррозия концентрационных ячеек кислородного типа часто является объяснением преимущественной коррозии нижней стороны медных водяных трубок. Нижняя сторона трубы часто контактирует с ненарушенной почвой с пониженным содержанием кислорода, тогда как верхняя часть трубы подвергается засыпке с воздухом. Коррозия на нижней стороне трубки усугубляется существующим большим отношением площади катода к площади анода. Ячейки с дифференциальной концентрацией кислорода также могут быть созданы за счет неоднородной засыпки.Металлы и сплавы, контактирующие с кусками глины, почти всегда будут анодными по отношению к ближайшему металлу, когда основным материалом засыпки является супесчаный суглинок. Точно так же могут существовать протяженные токи коррозии, если линия обслуживания проходит через участки с большими перепадами почвы.

    Коррозия подземной меди может быть вызвана определенными ячейками концентрации нейтральных солей. Области с повышенным содержанием хлоридов обычно анодны по отношению к областям с пониженным содержанием хлоридов. Такие концентрационные ячейки хоридного типа иногда создаются с помощью противообледенительных солей, например, в траншее, которое может действовать как подземный дренажный канал в течение нескольких лет после его выемки и обратной засыпки.

    Также есть основания полагать, что области на поверхности металла, контактирующие с почвой, имеющей низкий pH, будут катодными по сравнению с участками на том же металле, где локализованный pH несколько выше. Концепция ячеек с концентрацией водородных ионов частично подтверждается наблюдением, что потенциал коррозии металла или сплава обычно становится все более положительным по мере снижения pH окружающей среды. 7

    Вернуться к началу

    Коррозия от рассеянного постоянного тока

    Коррозия или помехи из-за рассеянного тока, которые слишком часто ошибочно называют «электролизом», могут возникать на подземных медных водопроводных трубах, когда в этом районе существуют неконтролируемые постоянные токи.Эта форма коррозии связана с величиной и направлением постоянных токов, текущих в земле по путям, отличным от предназначенных. Когда блуждающие токи протекают по подземной конструкции, коррозия не происходит, поскольку эти участки имеют катодную защиту. Эти паразитные токи также не вызывают ухудшения, когда они протекают внутри и вдоль конструкции. Однако токи в конечном итоге должны покинуть структуру, вернуться на землю и течь к своему источнику генерации. Области, где эти токи покидают конструкцию и входят в почву, являются анодными, и в этих местах может возникнуть серьезная коррозия.

    Обычным источником паразитной электроэнергии постоянного тока являются системы катодной защиты с подаваемым током, такие как те, которые широко используются коммунальными предприятиями, компаниями по транспортировке газа и нефти для снижения коррозии подземных стальных трубопроводов. Системы электропередачи высокого напряжения постоянного тока (HVDC), транзитные системы с питанием от постоянного тока, сварочное оборудование и горнодобывающее оборудование также являются потенциальными источниками паразитного постоянного тока.

    Вернуться к началу

    Неисправность конструкции и изготовления

    В дополнение к проблемам, создаваемым аномально агрессивными почвами, концентрационными ячейками и случайным постоянным током, коррозия подземной меди может усугубляться неправильной конструкцией и производством.

    Необходимо сделать поправку на тепловое расширение и сжатие, когда медные водопроводные трубы проходят через бетонную плиту здания. Если этого не сделать, иногда может возникнуть коррозионная усталость на выпуклой поверхности труб вблизи того места, где они проходят через бетон. 5, 8 Коррозионная усталость проявляется при хрупком типе, наличие поперечных трещин в пластичной трубе. Хотя случаи коррозионной усталости случаются редко, они могут возникать на неправильно установленных под плитами линиях горячего водоснабжения, где имеют место периодические расширения и сжатия.

    Также известно, что неправильно подготовленные или установленные развальцованные трубные соединения на подземных коммуникациях, вызванные наличием остаточных заусенцев на посадочной поверхности, могут привести к локальной эрозии и коррозии. Когда это происходит, проблема легко распознается по U-образным ямкам на пораженных участках, которые практически не содержат остаточных продуктов коррозии (рисунок ниже).

    Это может усугубляться ненормально высокой скоростью воды в системе распределения.

    Вернуться к началу

    Переменный ток, действие

    Роль переменного тока в подземной коррозии меди изучена недостаточно. 9 Некоторые исследователи утверждают, что любой металл, растворенный во время анодного полупериода, должен быть переотложен в течение катодного полупериода. Другие считают, что эффективность анодного полупериода выше, чем эффективность катодного полупериода, и, следовательно, может возникнуть коррозия, вызванная переменным током. Сохраняется аргумент относительно того, может ли оксид меди на внешней поверхности подземной медной водяной трубы исправлять переменный ток, хотя некоторые недавние исследования показывают, что такого исправления не происходит. 10, 11

    Некоторые исследователи полагают, что критическая плотность переменного тока должна быть превышена для возникновения коррозии на переменном токе. 12, 13 Также возможно, что переменный ток способствует деполяризации локальных анодов и катодов на подземной медной поверхности. 11 Ожидается, что эта деполяризация увеличит плотность тока коррозии и, как следствие, скорость коррозии.

    До тех пор, пока эти разногласия не будут согласованы и результаты недавних исследований не подтверждены, разумно полагать, что обычно применяемая практика заземления электрических систем на подземные медные водные системы может привести к коррозии.Если медная водопроводная система подключена к непроводящей магистрали, такой как асбестоцемент, можно ожидать некоторого коррозионного повреждения там, где ток выходит из меди, даже если ток переменный. Кроме того, закись меди может стать полупроводником при определенных условиях pH почвы и напряженности электрического поля. Заземление системы переменного тока на подземные медные водопроводные трубы и дисбаланс в системе переменного тока вполне могут быть вовлечены в процесс подземной коррозии.

    Вернуться к началу

    Термогальванические эффекты

    Движущий потенциал для коррозии меди может быть создан из-за разницы температур в линиях горячей и холодной бытовой воды под плитой, которые находятся в металлическом контакте друг с другом в водонагревателе.Это явление следует заподозрить, если внешняя коррозия медных водопроводов происходит только на трубах с горячей водой.

    Тепловые эффекты в непосредственной близости от подземных водопроводных труб могут иногда усугублять проблему коррозии из-за концентрации солей в этих местах за счет испарения воды, которая может стекать через почву.

    Гальваническое действие. Хотя медь обычно является катодом по отношению к наиболее часто используемым подземным металлам и сплавам, таким как сталь, гальванизированная сталь и чугун, подземные медные трубопроводы могут иметь две формы гальванической коррозии. 14 Это углеродно-медные ячейки, связанные с определенными заполнителями из шлака, и ячейка «медь-почва-медь-бетон», связанная со строительством на плите.

    Медь анодна по отношению к углероду, и можно ожидать возникновения коррозии, если огарки, используемые для засыпки, содержат заметные количества углерода. Однако для этого гальванического действия должна присутствовать влага.

    Также известно, что медь, внедренная в бетон, обычно будет катодной по отношению к ближайшей меди, которая подвергается воздействию почвы.Эта тонкая форма гальванической коррозии может вызвать разрушение меди, контактирующей с почвой в непосредственной близости от границы раздела грунт-бетон. Сообщается, что эта форма коррозии является причиной того, что в некоторых районах Южной Калифорнии требуется полное бетонное покрытие медных водяных труб. 5

    Вернуться к началу

    Выявление проблемы коррозии без выемки грунта

    Обследование с близким интервалом между трубами и почвой часто можно использовать для прогнозирования тех областей, где имеет место активная коррозия подземной меди. 15-17

    На основании одного исследования, 17 , которое подтверждается другим, 18 , можно предположить, что данные в Таблице 1 могут быть использованы для прогнозирования коррозионной активности в подземной медно-водопроводной системе.

    Подобные потенциальные исследования могут быть использованы для выявления основных областей коррозии от блуждающих токов.

    Таблица 1 . Ориентировочная корреляция между потенциалом трубы и почвы и активностью меди в подземной коррозии 17
    V-потенциал по сравнению с сульфатом меди-меди Коррозионная активность
    -0.5 или более отрицательных Медь хорошо защищена; предполагает, что медь имеет катодную защиту
    -0,25 или более отрицательное Отсутствие коррозии в большинстве почв
    -0,1 или менее отрицательное Может вызывать коррозию
    0,0 или положительный Вероятно, коррозия

    Как правило, отрицательные потенциалы регистрируются там, где паразитный ток попадает в медную трубку и материал катодно защищен.Гораздо меньше отрицательных и даже положительных потенциалов будет получено там, где блуждающий ток покидает подземную конструкцию, возвращается в землю и вызывает коррозию. Блуждающая коррозия также может быть подтверждена с помощью метода исследования потенциала от трубы до почвы. Прерывание источника тока, вызывающего нарушение, часто выявляет значительные потенциальные различия между показаниями обесточенного и включенного тока, особенно если эталонная ячейка расположена в месте основной анодной активности.

    Вернуться к началу

    Смягчение подземной коррозии меди

    Подземную коррозию меди можно эффективно уменьшить с помощью ряда методов.К ним относятся:

    • катодная защита,
    • дренаж улучшенный,
    • предотвращение неоднородных и золошлаковых засыпок,
    • разумное использование выборочных неагрессивных реакций,
    • надлежащий дизайн системы и стандартное качество изготовления и
    • уменьшение коррозии, вызванной паразитными токами.

    Катодная защита является одним из наиболее экономичных методов снижения коррозии меди, подверженной воздействию агрессивных сред. 17, 19 Контроль коррозии достигается, когда потенциалы катодов на коррозирующей медной поверхности поляризованы до потенциалов холостого хода анодов местного действия. Для большинства систем медь-водяные трубки это легко сделать с помощью расходных анодов. Цинковые аноды могут использоваться в засыпных засыпках при условии, что удельное сопротивление грунта меньше примерно 2000 Ом-см. Упакованные магниевые аноды следует использовать, если удельное сопротивление почвы превышает примерно 2000 Ом-см.

    Хотя ток, необходимый для катодной защиты подземной меди, будет варьироваться в зависимости от местных почвенных условий, медь, очевидно, довольно легко поляризуется в большинстве почв. Ток, необходимый для защиты квадратного фута голой меди, может составлять всего 0,4–1,7 мА. 20 Вера в то, что для катодной защиты подземной меди требуются относительно небольшие токи, подтверждается наблюдением, что эта форма контроля электрохимической коррозии обычно достигается автоматически, когда технологические линии находятся в металлическом контакте с чугунной водопроводной сетью.Общие рекомендации по проектированию работоспособной системы катодной защиты подземной меди доступны в технической литературе.

    Для устранения проблем подземной коррозии меди можно использовать усовершенствования в схеме дренажа, позволяющие отводить воду от здания или линии обслуживания. Траншея, в которой проходит линия обслуживания, не должна располагаться непосредственно после дренажных систем канализации или водосточных водостоков. Точно так же траншея не должна быть резервуаром для противогололедных солей и удобрений для газонов.

    Для тех областей, где известно, что подземная медь будет подвергаться воздействию аномально агрессивных почв, можно полностью заключить металл в выборочную засыпку. Эти засыпки могут быть приготовлены путем смешивания песка с цементным порошком, просеянного грунта с мелом или просеянного грунта с измельченным известняком. Однако выборочная засыпка может не достичь поставленной цели, если дренаж таков, что агрессивные частицы могут концентрироваться и вступать в контакт с медью.

    Коррозия подземной меди, вызванная рассеянным током, должна устраняться ответственной организацией. Эта опасная форма подземной коррозии легко становится безвредной за счет резистивных соединений и правильной установки расходуемых анодов на поврежденную конструкцию. В тяжелых условиях, когда источником помехи является система катодной защиты с подаваемым током, иногда необходимо переместить анодный слой, связанный с причиной помех.

    Трудно переоценить тот факт, что подземные системы медно-водопроводных труб должны быть правильно спроектированы и установлены. Необходимо предусмотреть возможность теплового расширения в местах прохождения медных труб для горячей воды через бетонные плиты. Следует избегать неправильно установленных развальцованных трубных соединений на медных коммуникационных линиях.

    Вернуться к началу

    Резюме

    Медные водяные трубы обладают выдающейся устойчивостью к коррозии в большинстве подземных сред. Медь не подвергается естественной коррозии в большинстве глин, мелов, суглинков, песков и гравий.Однако некоторые агрессивные почвенные условия могут вызвать коррозию. Основной предпосылкой коррозии является присутствие значительного количества влаги. Другие факторы, которые могут способствовать процессу коррозии, включают почвы, имеющие: (1) повышенные концентрации сульфатов, хлоридов, соединений аммиака или сульфидов; (2) плохая аэрация, которая поддерживает активность анаэробных бактерий; (3) большие количества органической или неорганической кислоты; и (4) большой перепад кислорода или нейтральных солей (особенно хлоридов).

    Медь также подвержена коррозии из-за рассеянного электричества постоянного тока. Очевидно, на него могут отрицательно повлиять определенные условия в системе переменного тока, к которым он может быть заземлен. Сообщается, что подземная медь подвержена термогальваническим эффектам и коррозии разнородных материалов. Медные водяные трубы могут иногда испытывать коррозионную усталость.

    К счастью, в тех редких случаях, когда медь подвергается коррозии в подземной среде, причину ухудшения качества можно определить.Как только это будет достигнуто, коррозию можно экономически уменьшить с помощью различных методов.

    Вернуться к началу

    Список литературы

    1. Медный грунт: устойчивость к коррозии почвы.
      Copper Development Assn. Publ. 40. Лондон (1947).
    2. ДЕНИСОН, И.А. Электролитическое поведение черных и цветных металлов в почвенно-коррозионных контурах.
      Пер. Electrochemical Soc., 81: 435 (1942).
    3. GILBERT, P.T. Коррозия образцов меди, свинца и свинцовых сплавов после захоронения в ряде почв на срок до 10 лет.
      Jour. Inst. металлов, 73: 139 (1947).
    4. РОМАНОФФ, М. Подземная коррозия.
      Natl. Бу. Циркуляра стандартов 579. NBS, Вашингтон, округ Колумбия (1957).
    5. WOODSIDE, R.D .; WATERS, F.O .; И CORNET, Коррозия и другие проблемы в медных трубах в некоторых жилых районах Южной Калифорнии.
      Proc. Третий международный Конгресс Металлической Коррозии, Москва (1966).
    6. KROON D.H. Обнаружение коррозии медных концентрических нейтралей на кабеле URD.
      Proc. Анна. Краткий курс по подземной коррозии Аппалачей, Моргантаун, В.Ва. (1979).
    7. MYERS, J.R .; BECK, F.H .; И ФОНТАНА, М.Г. Анодное поляризационное поведение никель-хромовых сплавов в растворах серной кислоты.
      Коррозия, 21: 277 (1965).
    8. WATERS, D.M. Внутренняя и внешняя коррозия меди в системах водоснабжения.
      Proc. AWWA Ann. Конф., Анахайм, Калифорния (май 1977 г.).
    9. ZASTROW, O.W. Влияние переменного тока на коррозию подземных электрических распределительных кабелей.
      Materials Performance, 20:12:41 (декабрь 1981 г.).
    10. УИЛЬЯМС, Дж.F. Коррозия металлов под действием переменного тока.
      Защита материалов, 5: 2: 52 (февраль 1966 г.).
    11. COMPTON, K.G. Коррозия концентрических нейтралов.
      Производительность материалов, 16:12 (1974).
    12. KRUGER, S. & BIRD, C.E. Коррозия металлов под воздействием переменного тока.
      British Corrosion journal, 13: 163 (1978).
    13. SERRA, E.T .; DE ARAUJO, M.M .; И MANN. HFIMER, W.A. О влиянии переменного тока на коррозию алюминия и меди при контакте с почвой.
      Proc. Коррозия ’79, Атланта (1979).
    14. ДЕНИСОН, И.А. И РОМАНОФФ, М. Исследования коррозии почвы, 1946 и 1948: медные сплавы, свинец и цинк.
      Jour. Res. Natl. Бу. Стандарты, 44: 259 (1950).
    15. KROON, D.H. Подземная коррозия меди.
      Proc. Коррозия ’75, Торонто, Онтарио, Канада (1975).
    16. HUSOCK, B. Использование возможных измерений для анализа коррозии концентрических нейтралов в кабелях URD.
      Proc. Коррозия ’78, Хьюстон (1979).
    17. Руководство по подземной коррозии в сельских электрических системах.
      Администрация электрификации сельских районов. Бык. 161-23. Министерство сельского хозяйства США, Вашингтон, округ Колумбия (1977).
    18. KROON, D.H. Оценка коррозии и катодная защита кабеля URD.
      Proc. Коррозия ’76, Хьюстон (1976).
    19. ROGERS, P.C .; GROSS, E.E .; И ХАСОК Б. Катодная защита подземных теплотрасс.
      Защита материалов, 1: 7 (1962).

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *